Incidental Mutation 'R6005:Slc25a44'
ID479398
Institutional Source Beutler Lab
Gene Symbol Slc25a44
Ensembl Gene ENSMUSG00000050144
Gene Namesolute carrier family 25, member 44
SynonymsB430110G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6005 (G1)
Quality Score121.008
Status Validated
Chromosome3
Chromosomal Location88410498-88425139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88412846 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 269 (E269K)
Ref Sequence ENSEMBL: ENSMUSP00000141780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056370] [ENSMUST00000057935] [ENSMUST00000168755] [ENSMUST00000192909] [ENSMUST00000193338] [ENSMUST00000193433] [ENSMUST00000195657]
Predicted Effect probably benign
Transcript: ENSMUST00000056370
SMART Domains Protein: ENSMUSP00000062420
Gene: ENSMUSG00000028066

DomainStartEndE-ValueType
Pfam:Nnf1 68 168 2.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057935
AA Change: E288K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057871
Gene: ENSMUSG00000050144
AA Change: E288K

DomainStartEndE-ValueType
Pfam:Mito_carr 38 124 7.1e-17 PFAM
Pfam:Mito_carr 124 232 1.3e-18 PFAM
Pfam:Mito_carr 239 325 4.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168755
SMART Domains Protein: ENSMUSP00000130075
Gene: ENSMUSG00000050144

DomainStartEndE-ValueType
Pfam:Mito_carr 36 124 1.1e-17 PFAM
Pfam:Mito_carr 124 227 5.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192365
Predicted Effect probably benign
Transcript: ENSMUST00000192909
Predicted Effect probably benign
Transcript: ENSMUST00000193338
SMART Domains Protein: ENSMUSP00000141696
Gene: ENSMUSG00000028066

DomainStartEndE-ValueType
Pfam:Nnf1 5 100 4.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193433
AA Change: E269K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141465
Gene: ENSMUSG00000050144
AA Change: E269K

DomainStartEndE-ValueType
Pfam:Mito_carr 17 105 2e-17 PFAM
Pfam:Mito_carr 105 214 3e-18 PFAM
Pfam:Mito_carr 220 306 1.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195657
AA Change: E269K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141780
Gene: ENSMUSG00000050144
AA Change: E269K

DomainStartEndE-ValueType
Pfam:Mito_carr 17 105 2e-17 PFAM
Pfam:Mito_carr 105 214 3e-18 PFAM
Pfam:Mito_carr 220 306 1.2e-17 PFAM
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A44 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Slc25a44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc25a44 APN 3 88416062 missense probably benign
R1199:Slc25a44 UTSW 3 88420986 missense probably damaging 0.99
R1283:Slc25a44 UTSW 3 88420578 missense probably damaging 1.00
R1590:Slc25a44 UTSW 3 88416007 missense possibly damaging 0.94
R6261:Slc25a44 UTSW 3 88420911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAAACCACAGCCTCTC -3'
(R):5'- TAGGCAGGGTTAAGTCCACC -3'

Sequencing Primer
(F):5'- AGCCTCTCCATCCACCG -3'
(R):5'- TCTGTCACCAGAGCTAGGAG -3'
Posted On2017-06-26