Incidental Mutation 'R6005:Tas2r113'
ID479418
Institutional Source Beutler Lab
Gene Symbol Tas2r113
Ensembl Gene ENSMUSG00000056926
Gene Nametaste receptor, type 2, member 113
SynonymsT2R13, mGR13, mt2r58, Tas2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132893011-132893940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132893696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 229 (R229K)
Ref Sequence ENSEMBL: ENSMUSP00000078044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079035]
Predicted Effect probably benign
Transcript: ENSMUST00000079035
AA Change: R229K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078044
Gene: ENSMUSG00000056926
AA Change: R229K

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 9.4e-78 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tas2r113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tas2r113 APN 6 132893152 missense probably benign 0.01
IGL01118:Tas2r113 APN 6 132893315 missense probably benign 0.00
IGL01366:Tas2r113 APN 6 132893797 missense probably benign 0.06
IGL01955:Tas2r113 APN 6 132893854 missense probably benign
IGL02629:Tas2r113 APN 6 132893336 missense probably damaging 1.00
IGL02681:Tas2r113 APN 6 132893367 missense probably damaging 1.00
IGL02883:Tas2r113 APN 6 132893419 missense probably damaging 1.00
R0002:Tas2r113 UTSW 6 132893779 missense probably benign 0.21
R0309:Tas2r113 UTSW 6 132893378 missense probably damaging 1.00
R1700:Tas2r113 UTSW 6 132893792 missense possibly damaging 0.92
R1748:Tas2r113 UTSW 6 132893732 missense probably damaging 0.98
R1854:Tas2r113 UTSW 6 132893329 missense probably damaging 1.00
R1974:Tas2r113 UTSW 6 132893833 missense probably benign 0.00
R4697:Tas2r113 UTSW 6 132893516 missense probably benign 0.04
R4798:Tas2r113 UTSW 6 132893707 missense possibly damaging 0.69
R4816:Tas2r113 UTSW 6 132893782 missense probably benign 0.09
R4906:Tas2r113 UTSW 6 132893558 missense possibly damaging 0.69
R6012:Tas2r113 UTSW 6 132893681 missense probably damaging 1.00
R6107:Tas2r113 UTSW 6 132893014 missense probably damaging 1.00
R6603:Tas2r113 UTSW 6 132893458 missense probably benign 0.01
R7263:Tas2r113 UTSW 6 132893576 missense possibly damaging 0.90
X0022:Tas2r113 UTSW 6 132893296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTAGTGACCCTGTTAGTGTCTC -3'
(R):5'- GAGAGAAGCCAATCTCAATCTTC -3'

Sequencing Primer
(F):5'- TGATAGTGTTCAAAGAAATGTGTCTC -3'
(R):5'- GAAGCCAATCTCAATCTTCTGTTTAC -3'
Posted On2017-06-26