Incidental Mutation 'R6005:Coq8b'
ID479419
Institutional Source Beutler Lab
Gene Symbol Coq8b
Ensembl Gene ENSMUSG00000003762
Gene Namecoenzyme Q8B
Synonyms0610012P18Rik, Adck4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R6005 (G1)
Quality Score107.008
Status Validated
Chromosome7
Chromosomal Location27233023-27257950 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 27257325 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 468 (Q468*)
Ref Sequence ENSEMBL: ENSMUSP00000104015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003860] [ENSMUST00000079258] [ENSMUST00000108378] [ENSMUST00000128090]
Predicted Effect probably null
Transcript: ENSMUST00000003860
AA Change: Q468*
SMART Domains Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762
AA Change: Q468*

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.9e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079258
SMART Domains Protein: ENSMUSP00000078245
Gene: ENSMUSG00000063160

DomainStartEndE-ValueType
PTB 75 205 1.11e-38 SMART
low complexity region 234 260 N/A INTRINSIC
Pfam:NumbF 287 371 3.5e-32 PFAM
coiled coil region 417 444 N/A INTRINSIC
low complexity region 532 574 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108378
AA Change: Q468*
SMART Domains Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762
AA Change: Q468*

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.4e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123012
Predicted Effect probably benign
Transcript: ENSMUST00000128090
SMART Domains Protein: ENSMUSP00000123309
Gene: ENSMUSG00000003762

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 304 3.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152342
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Coq8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Coq8b APN 7 27257477 missense probably benign
IGL01116:Coq8b APN 7 27239857 missense possibly damaging 0.82
IGL01123:Coq8b APN 7 27240084 missense probably damaging 1.00
IGL02949:Coq8b APN 7 27256613 missense possibly damaging 0.70
R0067:Coq8b UTSW 7 27233481 missense possibly damaging 0.87
R0690:Coq8b UTSW 7 27242249 missense probably benign 0.15
R1307:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1551:Coq8b UTSW 7 27257482 missense probably damaging 1.00
R1682:Coq8b UTSW 7 27240124 missense probably benign 0.00
R1895:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R1945:Coq8b UTSW 7 27233980 small insertion probably benign
R1945:Coq8b UTSW 7 27233981 small insertion probably benign
R1946:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R2069:Coq8b UTSW 7 27257377 missense probably damaging 1.00
R3758:Coq8b UTSW 7 27242227 nonsense probably null
R4545:Coq8b UTSW 7 27233505 missense probably benign 0.45
R4838:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R5181:Coq8b UTSW 7 27252322 missense possibly damaging 0.65
R5345:Coq8b UTSW 7 27250348 missense probably benign
R5806:Coq8b UTSW 7 27250625 nonsense probably null
R5943:Coq8b UTSW 7 27234003 missense probably damaging 1.00
R7028:Coq8b UTSW 7 27239868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTGCCTCTTCAGAAGTAATC -3'
(R):5'- CCCTGGATGGAATCTGTCATGG -3'

Sequencing Primer
(F):5'- CTTGCCTCTTCAGAAGTAATCAGAGG -3'
(R):5'- AGGTCCCTAGTCAGGAGGCTG -3'
Posted On2017-06-26