Incidental Mutation 'R6005:Timeless'
ID479433
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128244200 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 406 (R406H)
Ref Sequence ENSEMBL: ENSMUSP00000100879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000125289]
Predicted Effect probably damaging
Transcript: ENSMUST00000055539
AA Change: R406H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: R406H

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105240
Predicted Effect probably damaging
Transcript: ENSMUST00000105242
AA Change: R406H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: R406H

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105243
AA Change: R406H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994
AA Change: R406H

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105244
AA Change: R406H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: R406H

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105245
AA Change: R406H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: R406H

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125289
SMART Domains Protein: ENSMUSP00000132079
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 1 123 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 intron probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 unclassified probably null
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCCTCATCACAGGCATG -3'
(R):5'- CAACTGAAGGCTCTGTCAAAC -3'

Sequencing Primer
(F):5'- TCACAGGCATGAAAGACCG -3'
(R):5'- GGCTCTGTCAAACATAACCTTG -3'
Posted On2017-06-26