Incidental Mutation 'R6005:Ptpn21'
ID479435
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 98678552 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 1177 (*1177Q)
Ref Sequence ENSEMBL: ENSMUSP00000126975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535]
Predicted Effect probably null
Transcript: ENSMUST00000085116
AA Change: *1177Q
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: *1177Q

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170188
AA Change: *1177Q
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: *1177Q

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223321
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTCCAGACCTTGTGCAAGTG -3'
(R):5'- TTTCCCTCAGGAGTGCTGTC -3'

Sequencing Primer
(F):5'- CAGCAAACTGGGCAGCTGTG -3'
(R):5'- CAGGAGTGCTGTCTTCATCGC -3'
Posted On2017-06-26