Incidental Mutation 'R6005:Arid2'
ID479446
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96370972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 989 (S989P)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
Predicted Effect probably benign
Transcript: ENSMUST00000096250
AA Change: S989P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: S989P

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176739
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0400:Arid2 UTSW 15 96356925 unclassified probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2359:Arid2 UTSW 15 96361878 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3785:Arid2 UTSW 15 96372558 missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5620:Arid2 UTSW 15 96372506 missense probably benign 0.20
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6776:Arid2 UTSW 15 96370949 missense probably benign 0.00
R6985:Arid2 UTSW 15 96370148 missense probably benign 0.06
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATTGTGAGCCAGCCAG -3'
(R):5'- GATGAGACTAGACTCGTTGGG -3'

Sequencing Primer
(F):5'- TGTGAGCCAGCCAGCACAG -3'
(R):5'- TCGTTGGGAGCAGGCTGAC -3'
Posted On2017-06-26