Incidental Mutation 'R6007:Zfyve1'
ID479545
Institutional Source Beutler Lab
Gene Symbol Zfyve1
Ensembl Gene ENSMUSG00000042628
Gene Namezinc finger, FYVE domain containing 1
Synonyms
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6007 (G1)
Quality Score198.009
Status Validated
Chromosome12
Chromosomal Location83546558-83597222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83558704 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 407 (F407S)
Ref Sequence ENSEMBL: ENSMUSP00000152501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919] [ENSMUST00000222448]
Predicted Effect probably damaging
Transcript: ENSMUST00000048319
AA Change: F407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628
AA Change: F407S

DomainStartEndE-ValueType
low complexity region 429 436 N/A INTRINSIC
FYVE 590 660 8.36e-13 SMART
FYVE 707 776 1.15e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221919
AA Change: F407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222448
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Other mutations in Zfyve1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Zfyve1 APN 12 83574798 missense probably benign 0.09
IGL00475:Zfyve1 APN 12 83555711 critical splice acceptor site probably null
IGL01291:Zfyve1 APN 12 83555005 missense probably benign 0.04
IGL01380:Zfyve1 APN 12 83552507 missense probably damaging 1.00
IGL02037:Zfyve1 APN 12 83547920 missense probably damaging 1.00
IGL02184:Zfyve1 APN 12 83558693 missense probably benign 0.29
IGL02619:Zfyve1 APN 12 83550944 unclassified probably benign
IGL03031:Zfyve1 APN 12 83574821 missense probably damaging 0.99
IGL03105:Zfyve1 APN 12 83558639 missense probably damaging 1.00
sasso UTSW 12 83575056 missense probably damaging 1.00
ANU05:Zfyve1 UTSW 12 83555005 missense probably benign 0.04
R0123:Zfyve1 UTSW 12 83555073 splice site probably benign
R0225:Zfyve1 UTSW 12 83555073 splice site probably benign
R0468:Zfyve1 UTSW 12 83555274 splice site probably benign
R1218:Zfyve1 UTSW 12 83548051 missense possibly damaging 0.79
R1896:Zfyve1 UTSW 12 83555614 missense probably damaging 0.99
R2291:Zfyve1 UTSW 12 83547931 missense probably damaging 0.99
R4023:Zfyve1 UTSW 12 83594522 missense probably benign
R4026:Zfyve1 UTSW 12 83594522 missense probably benign
R4209:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4211:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4780:Zfyve1 UTSW 12 83558647 missense probably damaging 1.00
R4907:Zfyve1 UTSW 12 83574872 missense probably damaging 0.96
R4908:Zfyve1 UTSW 12 83551571 missense probably damaging 1.00
R4998:Zfyve1 UTSW 12 83548065 missense possibly damaging 0.69
R5076:Zfyve1 UTSW 12 83555647 missense probably damaging 1.00
R5303:Zfyve1 UTSW 12 83575056 missense probably damaging 1.00
R5628:Zfyve1 UTSW 12 83574889 missense probably benign 0.00
R5739:Zfyve1 UTSW 12 83575136 missense possibly damaging 0.61
R6355:Zfyve1 UTSW 12 83594641 missense probably benign 0.01
R6641:Zfyve1 UTSW 12 83594496 missense probably benign
R6735:Zfyve1 UTSW 12 83594844 missense possibly damaging 0.90
R7222:Zfyve1 UTSW 12 83555005 missense probably benign
R7278:Zfyve1 UTSW 12 83551540 missense probably damaging 1.00
R7464:Zfyve1 UTSW 12 83551487 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCGCTCAGATTCTATAATTTAAC -3'
(R):5'- CCAAGGCTTAGCTTCCTGTG -3'

Sequencing Primer
(F):5'- GGTAACTAACCTACACACCCAAGTC -3'
(R):5'- AAGGCTTAGCTTCCTGTGGTGAG -3'
Posted On2017-06-26