Incidental Mutation 'R6007:Zfp647'
ID479554
Institutional Source Beutler Lab
Gene Symbol Zfp647
Ensembl Gene ENSMUSG00000054967
Gene Namezinc finger protein 647
Synonyms
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76910371-76925448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76912085 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 125 (P125L)
Ref Sequence ENSEMBL: ENSMUSP00000155272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229865]
Predicted Effect probably benign
Transcript: ENSMUST00000048854
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: P125L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 17 77 7.05e-33 SMART
ZnF_C2H2 174 196 3.39e-3 SMART
ZnF_C2H2 202 224 1.2e-3 SMART
ZnF_C2H2 230 252 2.95e-3 SMART
ZnF_C2H2 258 280 4.79e-3 SMART
ZnF_C2H2 286 308 1.84e-4 SMART
ZnF_C2H2 314 336 6.32e-3 SMART
ZnF_C2H2 342 364 7.37e-4 SMART
ZnF_C2H2 370 392 1.6e-4 SMART
ZnF_C2H2 398 420 2.2e-2 SMART
ZnF_C2H2 426 448 6.78e-3 SMART
ZnF_C2H2 454 476 4.87e-4 SMART
ZnF_C2H2 482 504 2.24e-3 SMART
ZnF_C2H2 510 532 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229055
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably damaging
Transcript: ENSMUST00000229865
AA Change: P125L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Zfp647
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Zfp647 APN 15 76911670 nonsense probably null
IGL01680:Zfp647 APN 15 76917768 splice site probably benign
IGL02647:Zfp647 APN 15 76917715 missense probably damaging 1.00
IGL03213:Zfp647 APN 15 76911977 missense possibly damaging 0.46
IGL03401:Zfp647 APN 15 76911368 missense probably damaging 1.00
R0418:Zfp647 UTSW 15 76911386 missense probably damaging 1.00
R1479:Zfp647 UTSW 15 76911203 missense possibly damaging 0.94
R1913:Zfp647 UTSW 15 76911951 missense probably benign 0.02
R1959:Zfp647 UTSW 15 76911114 missense possibly damaging 0.57
R2176:Zfp647 UTSW 15 76911660 missense probably damaging 1.00
R3076:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3077:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3701:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3702:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3960:Zfp647 UTSW 15 76910976 unclassified probably null
R4938:Zfp647 UTSW 15 76911044 frame shift probably null
R4939:Zfp647 UTSW 15 76911044 frame shift probably null
R5196:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5197:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5345:Zfp647 UTSW 15 76911495 missense possibly damaging 0.48
R5415:Zfp647 UTSW 15 76911393 missense possibly damaging 0.79
R5791:Zfp647 UTSW 15 76918006 missense unknown
R5942:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5944:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5945:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5946:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5947:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6005:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6073:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6074:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6101:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6102:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6103:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6126:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6127:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6129:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6136:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6151:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6305:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6306:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6329:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6721:Zfp647 UTSW 15 76911876 missense probably benign 0.00
R7158:Zfp647 UTSW 15 76917305 missense probably benign 0.01
R7239:Zfp647 UTSW 15 76911756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTTCCACACTCAATGCAG -3'
(R):5'- ACTGTGAAGCAAAGCCAGC -3'

Sequencing Primer
(F):5'- CAGATATAGGGTCTCTCAACACTGG -3'
(R):5'- TTAAAGCAGCCCTTGTAGGTAGCC -3'
Posted On2017-06-26