Incidental Mutation 'R6007:4930407I10Rik'
List |< first << previous [record 18 of 1871] next >> last >|
ID479555
Institutional Source Beutler Lab
Gene Symbol 4930407I10Rik
Ensembl Gene ENSMUSG00000075524
Gene NameRIKEN cDNA 4930407I10 gene
SynonymsLOC328573
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.038) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82059151-82066540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 82062739 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 279 (T279S)
Ref Sequence ENSEMBL: ENSMUSP00000097965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100396]
Predicted Effect probably benign
Transcript: ENSMUST00000100396
AA Change: T279S

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097965
Gene: ENSMUSG00000075524
AA Change: T279S

DomainStartEndE-ValueType
Pfam:DUF4727 25 234 1.1e-109 PFAM
internal_repeat_1 321 406 9.89e-8 PROSPERO
low complexity region 453 465 N/A INTRINSIC
internal_repeat_2 593 707 6.03e-6 PROSPERO
low complexity region 735 752 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
internal_repeat_2 842 958 6.03e-6 PROSPERO
internal_repeat_1 876 962 9.89e-8 PROSPERO
low complexity region 985 996 N/A INTRINSIC
low complexity region 1117 1133 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1199 1208 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1282 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in 4930407I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:4930407I10Rik APN 15 82066380 missense probably benign 0.00
IGL02135:4930407I10Rik APN 15 82065004 missense possibly damaging 0.63
IGL02367:4930407I10Rik APN 15 82065547 missense probably benign 0.00
IGL02626:4930407I10Rik APN 15 82065609 missense probably damaging 0.99
IGL02885:4930407I10Rik APN 15 82063951 missense probably benign 0.36
IGL03199:4930407I10Rik APN 15 82062355 missense possibly damaging 0.65
R0062:4930407I10Rik UTSW 15 82063066 missense probably benign 0.00
R0062:4930407I10Rik UTSW 15 82066303 missense probably damaging 0.98
R0086:4930407I10Rik UTSW 15 82062601 missense probably benign 0.11
R0578:4930407I10Rik UTSW 15 82059355 missense possibly damaging 0.49
R1130:4930407I10Rik UTSW 15 82059360 missense probably benign
R1218:4930407I10Rik UTSW 15 82064152 missense probably benign 0.04
R1942:4930407I10Rik UTSW 15 82065424 missense probably damaging 0.98
R2380:4930407I10Rik UTSW 15 82064835 missense possibly damaging 0.92
R3945:4930407I10Rik UTSW 15 82065400 missense probably damaging 1.00
R4096:4930407I10Rik UTSW 15 82062205 missense probably benign 0.07
R4259:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4261:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4805:4930407I10Rik UTSW 15 82066427 nonsense probably null
R4992:4930407I10Rik UTSW 15 82064002 missense possibly damaging 0.60
R5094:4930407I10Rik UTSW 15 82062682 missense possibly damaging 0.72
R5161:4930407I10Rik UTSW 15 82063341 nonsense probably null
R5201:4930407I10Rik UTSW 15 82062544 missense probably benign 0.26
R5305:4930407I10Rik UTSW 15 82059219 missense possibly damaging 0.52
R5588:4930407I10Rik UTSW 15 82065216 missense possibly damaging 0.83
R5844:4930407I10Rik UTSW 15 82065864 missense probably benign 0.33
R6157:4930407I10Rik UTSW 15 82063416 missense possibly damaging 0.67
R6188:4930407I10Rik UTSW 15 82059270 missense probably benign 0.01
R6350:4930407I10Rik UTSW 15 82063563 missense possibly damaging 0.55
R6408:4930407I10Rik UTSW 15 82065106 missense possibly damaging 0.77
R6805:4930407I10Rik UTSW 15 82062543 missense possibly damaging 0.95
R6911:4930407I10Rik UTSW 15 82063867 missense probably benign 0.01
R6962:4930407I10Rik UTSW 15 82064949 missense probably benign 0.14
X0011:4930407I10Rik UTSW 15 82059285 missense probably damaging 1.00
X0026:4930407I10Rik UTSW 15 82063311 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTTAGCCTGAGGTAC -3'
(R):5'- TCCCACTCTGACACTGAGATC -3'

Sequencing Primer
(F):5'- GGTACACCTCCACAACTTTAGC -3'
(R):5'- ACTGAGATCTCGCCATCAGTG -3'
Posted On2017-06-26