Incidental Mutation 'R6008:Edn3'
ID479580
Institutional Source Beutler Lab
Gene Symbol Edn3
Ensembl Gene ENSMUSG00000027524
Gene Nameendothelin 3
Synonyms114CH19, 114-CH19, tmgc48
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location174760619-174784042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174779732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 149 (T149A)
Ref Sequence ENSEMBL: ENSMUSP00000125602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029030] [ENSMUST00000140908]
Predicted Effect probably benign
Transcript: ENSMUST00000029030
AA Change: T197A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029030
Gene: ENSMUSG00000027524
AA Change: T197A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
END 96 117 6.7e-6 SMART
END 158 179 1.53e-9 SMART
low complexity region 185 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137369
Predicted Effect probably benign
Transcript: ENSMUST00000140908
AA Change: T149A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125602
Gene: ENSMUSG00000027524
AA Change: T149A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
END 52 73 6.7e-6 SMART
END 114 135 1.53e-9 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162473
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene is a member of the endothelin family whose members encode proteins that act on G protein-coupled receptors. Endothelins are produced as large prepropolypeptide precursors that undergo a first cleavage by a subtilisin serine protease to form an inactive intermediate, which in turn is cleaved again by endothelin-converting enzyme 1 (ECE-1) to yield the active 21 amino acid peptide. This gene encodes a protein which is expressed in neural crest cells (NCC), binds to endothelin receptor b (Ednrb) and plays an essential role in the development of NCC-derived cell lineages including melanocytes and enteric neurons. Mutations in this gene are associated with terminal aganglionosis and white spotted coat in mice and Hirschsprung's disease and Waardenburg syndrome in humans. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for mutations at this locus exhibit aganglionic megacolon with white spotting of the hair coat due to impaired expansion and differentiation of epidermal melanoblasts. Mutants die around weaning with impacted colons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Ckap5 T A 2: 91,562,989 M405K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Ctnna2 A G 6: 76,915,828 L792P probably damaging Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Olfr559 T A 7: 102,724,367 Y41F probably damaging Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Pum1 T C 4: 130,768,847 V961A probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Spdye4c A T 2: 128,596,633 I304F probably benign Het
Sptbn2 A G 19: 4,739,278 I1249V possibly damaging Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Edn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0410:Edn3 UTSW 2 174761689 missense possibly damaging 0.58
R0540:Edn3 UTSW 2 174760974 missense probably damaging 1.00
R1900:Edn3 UTSW 2 174761605 missense possibly damaging 0.48
R2017:Edn3 UTSW 2 174778662 missense probably benign 0.00
R4571:Edn3 UTSW 2 174781904 missense probably benign 0.04
R4891:Edn3 UTSW 2 174761732 missense probably benign 0.11
R5218:Edn3 UTSW 2 174761552 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGTCCTACAGTTGGTGCCTG -3'
(R):5'- CCCAAAGGGTTACACAGGAC -3'

Sequencing Primer
(F):5'- GACACTTGGTCTGTGGGGAAC -3'
(R):5'- GAAGGTGACAAATGACCATATACAC -3'
Posted On2017-06-26