Incidental Mutation 'R6008:Ctnna2'
ID479592
Institutional Source Beutler Lab
Gene Symbol Ctnna2
Ensembl Gene ENSMUSG00000063063
Gene Namecatenin (cadherin associated protein), alpha 2
Synonymschp, Catna, alpha N-catenin, alpha(N)-catenin, Catna2
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location76881637-77979699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76915828 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 792 (L792P)
Ref Sequence ENSEMBL: ENSMUSP00000124764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075340] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161846] [ENSMUST00000204527]
Predicted Effect probably damaging
Transcript: ENSMUST00000075340
AA Change: L779P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063
AA Change: L779P

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159626
AA Change: L779P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063
AA Change: L779P

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160894
AA Change: L792P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063
AA Change: L792P

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161846
AA Change: L792P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063
AA Change: L792P

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204527
SMART Domains Protein: ENSMUSP00000144890
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 2 232 2.9e-94 PFAM
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Animals homozygous for a mutation of this gene exhibit ataxia, reduced body weight, reduced male fertility, and abnormalities of the brain which include a hypoplastic cerebellum, abnormal foliation pattern, ectopic Purkinje cells, and abnormal pyramidal cells in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Ckap5 T A 2: 91,562,989 M405K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Edn3 A G 2: 174,779,732 T149A probably benign Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Olfr559 T A 7: 102,724,367 Y41F probably damaging Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Pum1 T C 4: 130,768,847 V961A probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Spdye4c A T 2: 128,596,633 I304F probably benign Het
Sptbn2 A G 19: 4,739,278 I1249V possibly damaging Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Ctnna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ctnna2 APN 6 76980761 missense probably damaging 1.00
IGL00573:Ctnna2 APN 6 76902281 intron probably benign
IGL01290:Ctnna2 APN 6 76882560 missense possibly damaging 0.89
IGL01719:Ctnna2 APN 6 77636975 nonsense probably null
IGL01725:Ctnna2 APN 6 77641365 missense possibly damaging 0.89
IGL02381:Ctnna2 APN 6 76954783 missense probably benign 0.27
IGL02561:Ctnna2 APN 6 77845580 missense probably benign 0.34
IGL02653:Ctnna2 APN 6 76980777 missense probably benign 0.00
IGL02658:Ctnna2 APN 6 76980824 missense probably benign 0.00
IGL02721:Ctnna2 APN 6 76981869 missense probably damaging 0.99
IGL03075:Ctnna2 APN 6 76954730 missense probably benign 0.14
IGL03291:Ctnna2 APN 6 76973712 missense probably damaging 1.00
R0379:Ctnna2 UTSW 6 77641440 missense probably benign 0.01
R0423:Ctnna2 UTSW 6 77653069 missense probably damaging 1.00
R0539:Ctnna2 UTSW 6 76973899 missense probably damaging 1.00
R0540:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R0545:Ctnna2 UTSW 6 77605182 missense probably damaging 1.00
R0559:Ctnna2 UTSW 6 76915850 missense probably damaging 1.00
R0582:Ctnna2 UTSW 6 77758417 missense probably benign 0.07
R0607:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R1318:Ctnna2 UTSW 6 76882790 missense probably damaging 1.00
R1754:Ctnna2 UTSW 6 77636749 missense possibly damaging 0.61
R1838:Ctnna2 UTSW 6 77845542 missense probably damaging 0.99
R1924:Ctnna2 UTSW 6 76954847 missense possibly damaging 0.75
R1969:Ctnna2 UTSW 6 77758500 missense probably damaging 0.99
R2011:Ctnna2 UTSW 6 76973791 missense possibly damaging 0.47
R2867:Ctnna2 UTSW 6 77114922 splice site probably benign
R3103:Ctnna2 UTSW 6 77653144 missense possibly damaging 0.66
R3772:Ctnna2 UTSW 6 76973769 missense probably damaging 0.99
R3809:Ctnna2 UTSW 6 76954757 missense probably damaging 0.99
R4023:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4024:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4025:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4026:Ctnna2 UTSW 6 77636844 missense possibly damaging 0.90
R4288:Ctnna2 UTSW 6 77605221 missense probably damaging 0.96
R4291:Ctnna2 UTSW 6 76882745 missense probably damaging 1.00
R4493:Ctnna2 UTSW 6 76981848 missense probably damaging 0.99
R4561:Ctnna2 UTSW 6 77636713 critical splice donor site probably null
R4824:Ctnna2 UTSW 6 76980781 missense probably damaging 1.00
R4960:Ctnna2 UTSW 6 77653111 missense probably damaging 1.00
R4999:Ctnna2 UTSW 6 76915762 missense possibly damaging 0.86
R5041:Ctnna2 UTSW 6 76915763 missense probably damaging 1.00
R5093:Ctnna2 UTSW 6 77114929 critical splice donor site probably null
R5411:Ctnna2 UTSW 6 77114931 missense probably damaging 1.00
R5847:Ctnna2 UTSW 6 76973837 missense possibly damaging 0.87
R5874:Ctnna2 UTSW 6 76902430 missense probably benign 0.00
R5935:Ctnna2 UTSW 6 77143921 missense probably benign 0.01
R6115:Ctnna2 UTSW 6 77636839 missense probably benign 0.10
R6369:Ctnna2 UTSW 6 76980695 missense possibly damaging 0.88
R6490:Ctnna2 UTSW 6 77143909 missense probably benign
R7021:Ctnna2 UTSW 6 77636905 missense probably damaging 1.00
R7152:Ctnna2 UTSW 6 76980824 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGCTGTGAATCACTGTCATTTG -3'
(R):5'- CTTGAAACCATTGAGTCTGGC -3'

Sequencing Primer
(F):5'- AATCACTGTCATTTGGTGCTTTCAG -3'
(R):5'- GAAACCATTGAGTCTGGCATTTCTC -3'
Posted On2017-06-26