Incidental Mutation 'R0513:Adcy10'
ID47962
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 038707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R0513 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165519519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 368 (D368E)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 99% (122/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,659 T146A probably benign Het
4930452B06Rik A C 14: 8,536,609 D199E probably damaging Het
5830473C10Rik A T 5: 90,577,927 T333S probably benign Het
6720489N17Rik A C 13: 62,605,215 V99G possibly damaging Het
Abcg4 A G 9: 44,281,687 S121P possibly damaging Het
Actr2 T C 11: 20,080,124 T212A probably damaging Het
Anapc15 T C 7: 101,898,540 probably benign Het
Aox4 A G 1: 58,217,519 R67G probably benign Het
Aox4 A G 1: 58,247,300 D697G probably damaging Het
Arhgap42 A T 9: 9,005,765 S755T probably benign Het
Atm A G 9: 53,503,948 V881A probably benign Het
Cd163l1 C A 7: 140,224,960 C625* probably null Het
Cdkal1 C T 13: 29,625,965 probably benign Het
Cfap61 C A 2: 146,035,295 N491K possibly damaging Het
Chgb T C 2: 132,785,977 probably benign Het
Chrna1 C A 2: 73,568,082 probably benign Het
Chst10 A G 1: 38,865,763 L283P probably damaging Het
Clca3a1 A G 3: 144,760,562 probably null Het
Cryzl1 G T 16: 91,699,287 A1E possibly damaging Het
Csnk1a1 T C 18: 61,576,547 Y213H probably damaging Het
Cspg4 A G 9: 56,898,091 Q2062R probably benign Het
Ctnnal1 A G 4: 56,835,348 C310R probably benign Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
D930048N14Rik T C 11: 51,654,928 probably benign Het
Dag1 G A 9: 108,208,485 P486S possibly damaging Het
Dgkq A G 5: 108,656,495 L33P probably benign Het
Dlc1 C T 8: 36,584,010 G856R probably damaging Het
Dst T A 1: 34,219,531 probably benign Het
Dtl A T 1: 191,569,707 Y79* probably null Het
Egfr T G 11: 16,872,855 L406R probably damaging Het
Elp3 A T 14: 65,563,246 probably null Het
Fbxw19 C A 9: 109,481,553 probably null Het
Frs2 T C 10: 117,074,665 E264G possibly damaging Het
Fscn2 G T 11: 120,361,880 V58L probably damaging Het
Gm17324 G A 9: 78,448,725 probably benign Het
Gm4787 A T 12: 81,378,312 N357K probably benign Het
Gm9956 G T 10: 56,745,195 Het
Gsg1l C T 7: 126,020,623 probably null Het
Herc1 G A 9: 66,445,645 V2138M possibly damaging Het
Htr2a T C 14: 74,706,324 L448P probably benign Het
Ing3 C T 6: 21,970,035 S255L probably damaging Het
Ispd A T 12: 36,390,468 H125L probably damaging Het
Krt78 T C 15: 101,950,949 D271G probably damaging Het
Lmbrd2 T A 15: 9,194,729 L606H probably damaging Het
Lmod1 T A 1: 135,325,168 N53K probably damaging Het
Lsr G C 7: 30,958,338 A467G probably benign Het
Mbtd1 T A 11: 93,932,212 probably null Het
Mill1 T A 7: 18,264,877 Y337* probably null Het
Mlxipl A T 5: 135,137,263 Q833L probably benign Het
Mon2 C T 10: 123,038,610 V278M probably damaging Het
Mxra8 A C 4: 155,841,733 M180L probably benign Het
Myo18a A T 11: 77,811,594 probably benign Het
Myo1c T G 11: 75,665,831 probably null Het
Myo1g T C 11: 6,510,203 T782A probably benign Het
Ncapd3 A G 9: 27,064,105 probably benign Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nedd4l T A 18: 65,195,185 probably benign Het
Nf2 T C 11: 4,791,185 K343R possibly damaging Het
Nfasc A T 1: 132,603,846 D733E possibly damaging Het
Nolc1 G A 19: 46,084,159 D699N probably damaging Het
Nrbp2 C T 15: 76,088,976 A45T probably benign Het
Obscn A G 11: 59,061,522 V3907A possibly damaging Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1371 T C 11: 52,213,749 Q80R possibly damaging Het
Olfr145 A T 9: 37,898,055 Y217F probably damaging Het
Pank2 C T 2: 131,282,606 T290I probably damaging Het
Pbx4 T C 8: 69,864,879 V171A probably benign Het
Pcgf1 G T 6: 83,080,574 V75F probably damaging Het
Pik3ca T C 3: 32,461,511 S778P probably damaging Het
Pld6 T C 11: 59,785,221 I141M probably damaging Het
Polq T A 16: 37,094,502 V2508E probably damaging Het
Prkca C G 11: 108,014,376 D179H possibly damaging Het
Pspn T C 17: 56,999,720 S70G probably damaging Het
Ptchd4 C T 17: 42,503,746 T846I probably benign Het
Reg3g A C 6: 78,467,844 Y50* probably null Het
Rev3l C T 10: 39,828,143 H2062Y probably benign Het
Rsph4a C T 10: 33,912,991 Q611* probably null Het
Scgb1b20 G A 7: 33,373,314 probably null Het
Sfxn5 T C 6: 85,269,973 probably benign Het
Sh3tc1 T A 5: 35,700,307 Q1179L possibly damaging Het
Skint11 A G 4: 114,194,565 I37V probably benign Het
Slc35f5 T C 1: 125,576,169 probably benign Het
Slc8a2 A C 7: 16,157,339 D768A probably damaging Het
Slco6b1 A G 1: 96,997,184 noncoding transcript Het
Smurf2 T A 11: 106,836,105 T453S probably benign Het
Spag16 A G 1: 70,493,768 probably benign Het
Spindoc G A 19: 7,374,144 T205I probably benign Het
Stab1 T C 14: 31,148,945 I1316V probably benign Het
Stox2 T C 8: 47,193,865 R187G probably damaging Het
Tcea2 A C 2: 181,684,481 T93P probably benign Het
Tenm4 T C 7: 96,895,623 M2311T probably benign Het
Tmem63a A G 1: 180,960,461 Q260R probably benign Het
Tnpo2 A T 8: 85,053,529 H698L probably benign Het
Trim33 A G 3: 103,310,384 D215G probably damaging Het
Ttc3 T A 16: 94,426,212 I727N probably damaging Het
Ttn T A 2: 76,943,325 K2271N probably damaging Het
Ubr2 T A 17: 46,986,779 K223* probably null Het
Ubr4 A G 4: 139,416,875 M1410V possibly damaging Het
Ugt2b35 T C 5: 87,003,412 probably benign Het
Ulk4 T A 9: 121,152,325 H880L probably benign Het
Unc80 G A 1: 66,622,474 C1686Y possibly damaging Het
Upf2 T A 2: 5,957,667 L60Q unknown Het
Usf2 A T 7: 30,954,736 probably benign Het
Usp21 T A 1: 171,283,012 probably benign Het
Usp21 T A 1: 171,283,014 probably benign Het
Vmn2r118 T A 17: 55,610,970 K181* probably null Het
Vmn2r124 T A 17: 18,073,729 S693T possibly damaging Het
Vmn2r76 C A 7: 86,228,779 G470V probably benign Het
Vps13c A C 9: 67,930,735 I1856L probably benign Het
Vps50 C T 6: 3,520,210 L119F probably damaging Het
Wdfy3 T A 5: 101,890,789 S2012C probably damaging Het
Zfp142 A G 1: 74,571,555 V924A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp235 T C 7: 24,142,219 S688P probably damaging Het
Zfp39 C T 11: 58,889,987 V650I probably benign Het
Zfp82 A T 7: 30,056,840 N272K probably damaging Het
Zfyve21 A C 12: 111,823,264 D54A possibly damaging Het
Zfyve26 C T 12: 79,244,484 D2116N probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGACTCATGGACTCATGCAC -3'
(R):5'- TGCTTGAAGCCCAAACCAAGTCATC -3'

Sequencing Primer
(F):5'- gacctcacagcaacccac -3'
(R):5'- AAACCAAGTCATCCACTCTTTCTC -3'
Posted On2013-06-12