Incidental Mutation 'R6009:Setd5'
ID479647
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113110519 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 127 (K127R)
Ref Sequence ENSEMBL: ENSMUSP00000108782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably benign
Transcript: ENSMUST00000042889
AA Change: K108R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: K108R

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: K127R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: K127R

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: K127R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: K127R

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204377
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGATCATAATTACGGAGCC -3'
(R):5'- ACCTACCAAATGTTTCCAGGAC -3'

Sequencing Primer
(F):5'- GGATCATAATTACGGAGCCCCTCC -3'
(R):5'- AGCTTTAACATCAATCTCTCATTCC -3'
Posted On2017-06-26