Incidental Mutation 'R6010:Nop58'
ID479679
Institutional Source Beutler Lab
Gene Symbol Nop58
Ensembl Gene ENSMUSG00000026020
Gene NameNOP58 ribonucleoprotein
SynonymsMSSP, SIK similar protein, Nol5
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location59684971-59719044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59700912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 154 (S154R)
Ref Sequence ENSEMBL: ENSMUSP00000140250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027174] [ENSMUST00000185772] [ENSMUST00000189327] [ENSMUST00000190231] [ENSMUST00000190265] [ENSMUST00000191142]
Predicted Effect probably damaging
Transcript: ENSMUST00000027174
AA Change: S154R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027174
Gene: ENSMUSG00000026020
AA Change: S154R

DomainStartEndE-ValueType
Pfam:NOP5NT 2 66 1.1e-25 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185368
Predicted Effect probably benign
Transcript: ENSMUST00000185772
Predicted Effect probably benign
Transcript: ENSMUST00000187491
Predicted Effect probably benign
Transcript: ENSMUST00000187837
Predicted Effect probably benign
Transcript: ENSMUST00000188390
Predicted Effect probably benign
Transcript: ENSMUST00000189327
SMART Domains Protein: ENSMUSP00000139517
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
Pfam:NOP5NT 1 60 2.1e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000189919
AA Change: S79R
Predicted Effect probably benign
Transcript: ENSMUST00000190231
Predicted Effect probably damaging
Transcript: ENSMUST00000190265
AA Change: S24R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141100
Gene: ENSMUSG00000026020
AA Change: S24R

DomainStartEndE-ValueType
NOSIC 31 83 2.1e-33 SMART
low complexity region 88 109 N/A INTRINSIC
Pfam:Nop 123 179 5.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190759
Predicted Effect probably damaging
Transcript: ENSMUST00000191142
AA Change: S154R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140250
Gene: ENSMUSG00000026020
AA Change: S154R

DomainStartEndE-ValueType
Pfam:NOP5NT 1 66 3.2e-26 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
Pfam:Nop 253 401 2.7e-63 PFAM
coiled coil region 441 491 N/A INTRINSIC
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core component of box C/D small nucleolar ribonucleoproteins. Some box C/D small nucleolar RNAs (snoRNAs), such as U3, U8, and U14, are dependent upon the encoded protein for their synthesis. This protein is SUMOylated, which is necessary for high affinity binding to snoRNAs. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Nop58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Nop58 APN 1 59704083 missense probably damaging 0.98
R0584:Nop58 UTSW 1 59706760 missense probably benign 0.00
R1170:Nop58 UTSW 1 59704211 splice site probably benign
R1177:Nop58 UTSW 1 59700932 missense probably damaging 1.00
R1485:Nop58 UTSW 1 59698345 missense probably damaging 0.98
R1588:Nop58 UTSW 1 59702872 missense probably damaging 1.00
R4715:Nop58 UTSW 1 59696026 missense probably benign 0.00
R5611:Nop58 UTSW 1 59710513 unclassified probably benign
R5933:Nop58 UTSW 1 59704665 nonsense probably null
R5979:Nop58 UTSW 1 59702831 missense probably damaging 1.00
R6244:Nop58 UTSW 1 59702855 missense probably damaging 1.00
R6371:Nop58 UTSW 1 59711312 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCTGTCAAGATTTCATTTGCTGAG -3'
(R):5'- TGTATTGACAGTCCCTCATCAAG -3'

Sequencing Primer
(F):5'- GGAGTGGCCACAGTTAAATTTCC -3'
(R):5'- CTCATCAAGAGAATCAAAGCTTA -3'
Posted On2017-06-26