Incidental Mutation 'R6010:Olfr74'
ID479687
Institutional Source Beutler Lab
Gene Symbol Olfr74
Ensembl Gene ENSMUSG00000075142
Gene Nameolfactory receptor 74
SynonymsMOR174-4, mOR-EV, GA_x6K02T2Q125-49458388-49457432
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87973707-87974663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87974542 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 41 (V41E)
Ref Sequence ENSEMBL: ENSMUSP00000097428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099840]
Predicted Effect probably damaging
Transcript: ENSMUST00000099840
AA Change: V41E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097428
Gene: ENSMUSG00000075142
AA Change: V41E

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 5.4e-47 PFAM
Pfam:7tm_1 42 291 2e-17 PFAM
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Olfr74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Olfr74 APN 2 87974551 missense probably benign 0.27
IGL02119:Olfr74 APN 2 87974410 missense probably benign 0.38
IGL02332:Olfr74 APN 2 87974065 missense probably damaging 1.00
IGL02626:Olfr74 APN 2 87973724 missense probably benign
IGL03022:Olfr74 APN 2 87973997 missense probably benign 0.00
R1015:Olfr74 UTSW 2 87974087 missense probably benign 0.03
R1908:Olfr74 UTSW 2 87974059 missense possibly damaging 0.66
R2358:Olfr74 UTSW 2 87973722 missense probably benign 0.02
R3711:Olfr74 UTSW 2 87973722 missense probably benign 0.02
R4646:Olfr74 UTSW 2 87973798 missense probably benign 0.18
R4807:Olfr74 UTSW 2 87973751 missense probably benign 0.00
R5026:Olfr74 UTSW 2 87974020 missense probably damaging 1.00
R5928:Olfr74 UTSW 2 87974036 missense probably benign 0.06
R6243:Olfr74 UTSW 2 87974587 missense probably benign 0.00
R6534:Olfr74 UTSW 2 87974041 missense probably benign 0.00
R6848:Olfr74 UTSW 2 87974170 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCCACAAATCGGTCATATGC -3'
(R):5'- AGGCAATGCACACTTTACTTATCC -3'

Sequencing Primer
(F):5'- GGCTTCAGTTACTACAAAGACAC -3'
(R):5'- GCAAAAATGTGCTTCCTCATTAACC -3'
Posted On2017-06-26