Incidental Mutation 'R6010:Baz1b'
ID479702
Institutional Source Beutler Lab
Gene Symbol Baz1b
Ensembl Gene ENSMUSG00000002748
Gene Namebromodomain adjacent to zinc finger domain, 1B
SynonymsWSTF, Wbscr9
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135187264-135246129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135217451 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 585 (E585K)
Ref Sequence ENSEMBL: ENSMUSP00000002825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002825
AA Change: E585K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748
AA Change: E585K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142307
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality by P2, small size at birth, impaired double strand DNA repair, and heart defects. Mice heterozygous for a null allele exhibit hypercalcemia and heart defects. Mice homozygous for an ENU mutation exhibit craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Baz1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Baz1b APN 5 135216590 missense probably damaging 0.99
IGL00589:Baz1b APN 5 135196492 missense possibly damaging 0.50
IGL00736:Baz1b APN 5 135240032 missense probably damaging 1.00
IGL02053:Baz1b APN 5 135242466 missense probably benign 0.00
IGL02197:Baz1b APN 5 135209097 missense probably benign 0.20
IGL02236:Baz1b APN 5 135217284 missense probably damaging 1.00
IGL02351:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02358:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02424:Baz1b APN 5 135217979 missense probably damaging 1.00
IGL03051:Baz1b APN 5 135217225 missense probably benign 0.02
PIT4480001:Baz1b UTSW 5 135217965 missense probably damaging 1.00
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0365:Baz1b UTSW 5 135240131 missense probably benign 0.00
R0655:Baz1b UTSW 5 135242430 missense probably benign 0.00
R0698:Baz1b UTSW 5 135198221 missense probably damaging 1.00
R0959:Baz1b UTSW 5 135244222 missense probably damaging 1.00
R1411:Baz1b UTSW 5 135230323 missense possibly damaging 0.73
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1511:Baz1b UTSW 5 135217782 missense probably damaging 1.00
R1557:Baz1b UTSW 5 135218243 missense possibly damaging 0.94
R1674:Baz1b UTSW 5 135205111 missense probably damaging 1.00
R1760:Baz1b UTSW 5 135242524 missense probably benign
R1951:Baz1b UTSW 5 135216739 missense probably benign 0.11
R2058:Baz1b UTSW 5 135217225 missense probably benign 0.02
R2060:Baz1b UTSW 5 135205114 missense probably damaging 1.00
R2142:Baz1b UTSW 5 135217275 missense probably damaging 1.00
R2496:Baz1b UTSW 5 135210775 missense probably damaging 1.00
R4088:Baz1b UTSW 5 135216940 missense probably damaging 0.96
R4397:Baz1b UTSW 5 135244446 missense probably damaging 1.00
R4784:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R4785:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R5386:Baz1b UTSW 5 135238059 missense probably damaging 1.00
R5653:Baz1b UTSW 5 135209097 missense probably benign 0.20
R5808:Baz1b UTSW 5 135221958 missense probably benign 0.00
R6014:Baz1b UTSW 5 135217394 missense probably damaging 1.00
R6173:Baz1b UTSW 5 135242507 missense probably benign
R6194:Baz1b UTSW 5 135243890 missense probably damaging 0.99
R6419:Baz1b UTSW 5 135242494 missense probably benign
R6435:Baz1b UTSW 5 135237945 missense probably damaging 1.00
R7078:Baz1b UTSW 5 135217439 missense probably benign 0.04
X0027:Baz1b UTSW 5 135216892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAGCCCGTCTTCCAGAAG -3'
(R):5'- TGCACTCAAGGCTTCCATTAGG -3'

Sequencing Primer
(F):5'- GCTCTTGTCCAGAAACGCTATGAG -3'
(R):5'- TCCATTAGGGACACAGCAGTG -3'
Posted On2017-06-26