Incidental Mutation 'R6010:Agap2'
ID479716
Institutional Source Beutler Lab
Gene Symbol Agap2
Ensembl Gene ENSMUSG00000025422
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 2
SynonymsCentg1
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127075284-127093169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127090910 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 939 (I939F)
Ref Sequence ENSEMBL: ENSMUSP00000151946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039259] [ENSMUST00000080975] [ENSMUST00000164259] [ENSMUST00000217941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039259
AA Change: I959F

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043466
Gene: ENSMUSG00000025422
AA Change: I959F

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
low complexity region 222 257 N/A INTRINSIC
low complexity region 306 322 N/A INTRINSIC
low complexity region 349 376 N/A INTRINSIC
Pfam:Ras 402 562 3.6e-16 PFAM
low complexity region 575 590 N/A INTRINSIC
low complexity region 600 609 N/A INTRINSIC
PH 671 906 4.35e-14 SMART
ArfGap 925 1045 8.8e-62 SMART
low complexity region 1052 1071 N/A INTRINSIC
ANK 1084 1113 1.15e0 SMART
ANK 1117 1145 3.69e2 SMART
low complexity region 1148 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080975
SMART Domains Protein: ENSMUSP00000079770
Gene: ENSMUSG00000040462

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 2.3e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164259
SMART Domains Protein: ENSMUSP00000128914
Gene: ENSMUSG00000040462

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 8.6e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217941
AA Change: I939F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the centaurin GTPase family. This gene product regulates the activity of multiple kinases, including PI3K. Reduced expression of this gene results in multiple defects, including neural deficiencies, while increased expression of this gene has been observed in some tumors. Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lactation due to abnormal mammary gland growth during lactation, failure of insulin-suppressed gluconeogenesis, and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Agap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Agap2 APN 10 127087996 missense unknown
IGL01690:Agap2 APN 10 127082958 splice site probably benign
IGL01765:Agap2 APN 10 127083235 missense unknown
IGL02029:Agap2 APN 10 127080283 missense unknown
IGL02525:Agap2 APN 10 127083201 splice site probably null
IGL03019:Agap2 APN 10 127091562 splice site probably benign
R0086:Agap2 UTSW 10 127087882 splice site probably null
R0197:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R0345:Agap2 UTSW 10 127087895 missense unknown
R0363:Agap2 UTSW 10 127090965 missense probably damaging 1.00
R0682:Agap2 UTSW 10 127083482 missense unknown
R0787:Agap2 UTSW 10 127085150 missense unknown
R0882:Agap2 UTSW 10 127087450 missense unknown
R0883:Agap2 UTSW 10 127091702 missense possibly damaging 0.66
R1445:Agap2 UTSW 10 127091112 splice site probably benign
R1800:Agap2 UTSW 10 127091671 missense probably damaging 1.00
R1854:Agap2 UTSW 10 127080516 missense unknown
R1925:Agap2 UTSW 10 127090875 missense probably damaging 1.00
R1986:Agap2 UTSW 10 127083044 nonsense probably null
R2050:Agap2 UTSW 10 127080261 nonsense probably null
R2267:Agap2 UTSW 10 127082428 splice site probably benign
R2269:Agap2 UTSW 10 127082428 splice site probably benign
R4174:Agap2 UTSW 10 127090514 missense probably damaging 0.98
R4397:Agap2 UTSW 10 127090483 missense unknown
R4418:Agap2 UTSW 10 127091650 missense probably damaging 1.00
R4472:Agap2 UTSW 10 127091213 missense probably damaging 1.00
R4612:Agap2 UTSW 10 127080096 missense unknown
R4690:Agap2 UTSW 10 127091375 missense possibly damaging 0.91
R4744:Agap2 UTSW 10 127090203 critical splice donor site probably null
R5316:Agap2 UTSW 10 127082427 splice site probably null
R5533:Agap2 UTSW 10 127083042 missense unknown
R5680:Agap2 UTSW 10 127088011 missense unknown
R6276:Agap2 UTSW 10 127089360 critical splice donor site probably null
R6356:Agap2 UTSW 10 127082996 missense unknown
R7138:Agap2 UTSW 10 127087285 missense unknown
Z1088:Agap2 UTSW 10 127088242 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGGAAACTCGACCTGTGTG -3'
(R):5'- AGGAATCGTACACCCTCACG -3'

Sequencing Primer
(F):5'- AAACTCGACCTGTGTGGACTG -3'
(R):5'- TCGATCCTTACCGCGAAGAGTC -3'
Posted On2017-06-26