Incidental Mutation 'R6010:Psme2'
ID479728
Institutional Source Beutler Lab
Gene Symbol Psme2
Ensembl Gene ENSMUSG00000079197
Gene Nameproteasome (prosome, macropain) activator subunit 2 (PA28 beta)
SynonymsPA28b
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55587441-55591113 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 55587523 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000022828] [ENSMUST00000111378] [ENSMUST00000137296] [ENSMUST00000159687] [ENSMUST00000161807]
Predicted Effect probably null
Transcript: ENSMUST00000019443
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022828
SMART Domains Protein: ENSMUSP00000022828
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 3 191 1.9e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111378
AA Change: V220F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107009
Gene: ENSMUSG00000079197
AA Change: V220F

DomainStartEndE-ValueType
Pfam:PA28_alpha 1 64 2.2e-26 PFAM
Pfam:PA28_beta 82 231 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137296
SMART Domains Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 66 151 6.8e-17 PFAM
Blast:RING 214 257 3e-17 BLAST
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 404 428 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140178
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159297
Predicted Effect probably benign
Transcript: ENSMUST00000159687
SMART Domains Protein: ENSMUSP00000125596
Gene: ENSMUSG00000079197

DomainStartEndE-ValueType
Pfam:PA28_alpha 1 64 1.2e-26 PFAM
Pfam:PA28_beta 82 165 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161573
Predicted Effect probably benign
Transcript: ENSMUST00000161807
AA Change: V228F

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123798
Gene: ENSMUSG00000079197
AA Change: V228F

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162700
Predicted Effect probably benign
Transcript: ENSMUST00000174352
SMART Domains Protein: ENSMUSP00000133463
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 1 43 6.3e-11 PFAM
Pfam:UPF0172 41 82 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174618
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring. Six pseudogenes have been identified on chromosomes 4, 5, 8, 10 and 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in impaired cytotoxic T lymphocyte responses and immunoproteasome assembly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Psme2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Psme2 APN 14 55588436 unclassified probably benign
IGL01462:Psme2 APN 14 55589671 missense probably damaging 1.00
R1853:Psme2 UTSW 14 55588479 missense probably damaging 1.00
R2103:Psme2 UTSW 14 55590840 critical splice donor site probably null
R4093:Psme2 UTSW 14 55588277 missense probably benign 0.01
R5999:Psme2 UTSW 14 55590082 missense probably damaging 1.00
R6620:Psme2 UTSW 14 55588471 missense probably damaging 1.00
R7106:Psme2 UTSW 14 55588237 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGACTTCCTGCAACCACTTA -3'
(R):5'- GCGAGATGAAGCAGCCTAT -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CTATGGGGCGCTTAGGGC -3'
Posted On2017-06-26