Incidental Mutation 'R6011:Adcy5'
ID479775
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6011 (G1)
Quality Score188.009
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35157228 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 377 (L377P)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably benign
Transcript: ENSMUST00000114913
AA Change: L377P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: L377P

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTATGCGCTCATTGCAGTG -3'
(R):5'- AGCATTACAAGCCTTACAAGAGTAG -3'

Sequencing Primer
(F):5'- TGGCCGTCCAGGTAGTG -3'
(R):5'- GCCTTACAAGAGTAGTCTTTAGTAGG -3'
Posted On2017-06-26