Incidental Mutation 'R6011:Amer1'
List |< first << previous [record 25 of 686] next >> last >|
ID479784
Institutional Source Beutler Lab
Gene Symbol Amer1
Ensembl Gene ENSMUSG00000050332
Gene NameAPC membrane recruitment 1
SynonymsFam123b, Wtx, 2810002O09Rik, Amer1
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6011 (G1)
Quality Score133.973
Status Not validated
ChromosomeX
Chromosomal Location95420318-95444872 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC to ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC at 95427283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084535]
Predicted Effect probably benign
Transcript: ENSMUST00000084535
SMART Domains Protein: ENSMUSP00000109502
Gene: ENSMUSG00000050332

DomainStartEndE-ValueType
Pfam:WTX 89 556 3.5e-128 PFAM
low complexity region 591 615 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 789 799 N/A INTRINSIC
low complexity region 904 913 N/A INTRINSIC
low complexity region 934 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene upregulates trancriptional activation by the Wilms tumor protein and interacts with many other proteins, including CTNNB1, APC, AXIN1, and AXIN2. Defects in this gene are a cause of osteopathia striata with cranial sclerosis (OSCS). [provided by RefSeq, May 2010]
PHENOTYPE: Male mice hemizygous for a null mutation display neonatal lethality with cardiac overgrowth, bone overgrowth, bilateral or unilateral renal agenesis coupled with renal overgrowth, adipocyte and spleen hypoplasia, and altered mesenchymal progenitor cell fate specification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Amer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Amer1 APN X 95427110 missense probably benign
IGL02514:Amer1 APN X 95426511 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTGGGAGCAGACTCTTGCTG -3'
(R):5'- GATGGGACCAAGCGAAGTTC -3'

Sequencing Primer
(F):5'- GTGTCAAAAGTTCTCCAAGGCCTAG -3'
(R):5'- CAAGCGAAGTTCCTGCTTGGTAAC -3'
Posted On2017-06-26