Incidental Mutation 'R6012:Hsd3b2'
ID479796
Institutional Source Beutler Lab
Gene Symbol Hsd3b2
Ensembl Gene ENSMUSG00000063730
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Synonyms
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98709255-98724543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98712017 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 204 (M204K)
Ref Sequence ENSEMBL: ENSMUSP00000136533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107021] [ENSMUST00000107022] [ENSMUST00000177651]
Predicted Effect probably benign
Transcript: ENSMUST00000107021
AA Change: M204K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102635
Gene: ENSMUSG00000063730
AA Change: M204K

DomainStartEndE-ValueType
Pfam:KR 5 130 3.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.1e-13 PFAM
Pfam:NmrA 6 139 7.7e-8 PFAM
Pfam:NAD_binding_10 6 207 1.4e-9 PFAM
Pfam:Epimerase 6 254 2.5e-26 PFAM
Pfam:3Beta_HSD 7 288 1.2e-112 PFAM
Pfam:NAD_binding_4 8 221 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107022
AA Change: M204K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102636
Gene: ENSMUSG00000063730
AA Change: M204K

DomainStartEndE-ValueType
Pfam:KR 5 130 3.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.1e-13 PFAM
Pfam:NmrA 6 139 7.7e-8 PFAM
Pfam:NAD_binding_10 6 207 1.4e-9 PFAM
Pfam:Epimerase 6 254 2.5e-26 PFAM
Pfam:3Beta_HSD 7 288 1.2e-112 PFAM
Pfam:NAD_binding_4 8 221 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177651
AA Change: M204K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136533
Gene: ENSMUSG00000063730
AA Change: M204K

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 6 136 1.2e-13 PFAM
Pfam:NmrA 6 140 1.7e-7 PFAM
Pfam:Epimerase 6 249 2.1e-25 PFAM
Pfam:GDP_Man_Dehyd 7 187 2.7e-13 PFAM
Pfam:3Beta_HSD 7 288 8.2e-114 PFAM
Pfam:NAD_binding_4 8 223 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Hsd3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hsd3b2 APN 3 98711543 missense possibly damaging 0.47
IGL01102:Hsd3b2 APN 3 98711679 missense probably damaging 0.97
IGL01733:Hsd3b2 APN 3 98716485 missense probably damaging 1.00
IGL02202:Hsd3b2 APN 3 98711867 missense possibly damaging 0.85
IGL02851:Hsd3b2 APN 3 98716424 missense possibly damaging 0.84
R1737:Hsd3b2 UTSW 3 98711546 missense probably damaging 1.00
R1800:Hsd3b2 UTSW 3 98712237 missense probably damaging 1.00
R1917:Hsd3b2 UTSW 3 98712026 missense probably benign
R4797:Hsd3b2 UTSW 3 98711663 missense probably damaging 1.00
R5354:Hsd3b2 UTSW 3 98712315 missense probably benign 0.39
R5412:Hsd3b2 UTSW 3 98711892 missense possibly damaging 0.88
R5940:Hsd3b2 UTSW 3 98711971 missense probably benign 0.02
R5954:Hsd3b2 UTSW 3 98711559 missense probably benign 0.06
R6083:Hsd3b2 UTSW 3 98712056 missense possibly damaging 0.94
R6675:Hsd3b2 UTSW 3 98713472 missense probably benign 0.02
X0054:Hsd3b2 UTSW 3 98713500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAAGCTTTGGTGAGGGG -3'
(R):5'- GGCCCAACTCTTACAAGGAG -3'

Sequencing Primer
(F):5'- GTGTCATCTGAGATGTAGTAGAACTC -3'
(R):5'- CAAGGAGATTGTCTTGAATGGCC -3'
Posted On2017-06-26