Incidental Mutation 'R6012:Mogs'
ID479807
Institutional Source Beutler Lab
Gene Symbol Mogs
Ensembl Gene ENSMUSG00000030036
Gene Namemannosyl-oligosaccharide glucosidase
SynonymsGcs1, 1810017N02Rik
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83115496-83118898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83117382 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 393 (S393R)
Ref Sequence ENSEMBL: ENSMUSP00000032114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032109] [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113935] [ENSMUST00000113936] [ENSMUST00000143814] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032109
SMART Domains Protein: ENSMUSP00000032109
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 129 137 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
Pfam:PAPA-1 198 282 1.6e-27 PFAM
Pfam:zf-HIT 294 325 6.1e-10 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000032114
AA Change: S393R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036
AA Change: S393R

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113935
SMART Domains Protein: ENSMUSP00000109568
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
Pfam:PAPA-1 228 309 4e-23 PFAM
Pfam:zf-HIT 324 355 4.3e-11 PFAM
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123394
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142493
Predicted Effect probably benign
Transcript: ENSMUST00000143814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145403
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Mogs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mogs APN 6 83118577 missense probably damaging 1.00
IGL02314:Mogs APN 6 83118055 missense probably benign 0.00
IGL02673:Mogs APN 6 83118218 missense probably damaging 1.00
IGL02862:Mogs APN 6 83115890 missense probably damaging 1.00
IGL02984:Mogs UTSW 6 83117315 missense probably benign 0.00
R1547:Mogs UTSW 6 83116025 missense possibly damaging 0.93
R1765:Mogs UTSW 6 83116803 missense probably benign 0.00
R2013:Mogs UTSW 6 83117650 nonsense probably null
R2015:Mogs UTSW 6 83117650 nonsense probably null
R3735:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R3736:Mogs UTSW 6 83116776 missense possibly damaging 0.88
R4279:Mogs UTSW 6 83116067 missense probably damaging 1.00
R4585:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R4586:Mogs UTSW 6 83118638 missense possibly damaging 0.56
R5783:Mogs UTSW 6 83118671 missense probably damaging 1.00
R5825:Mogs UTSW 6 83118212 missense possibly damaging 0.72
R6753:Mogs UTSW 6 83115882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACACTGAAAGCCCCTTTC -3'
(R):5'- AGCTGGTGAAAGCCTTCATCC -3'

Sequencing Primer
(F):5'- GAAAGCCCCTTTCTCTGTGGAG -3'
(R):5'- TGGTGAAAGCCTTCATCCCAGAG -3'
Posted On2017-06-26