Incidental Mutation 'R6012:Picalm'
ID479815
Institutional Source Beutler Lab
Gene Symbol Picalm
Ensembl Gene ENSMUSG00000039361
Gene Namephosphatidylinositol binding clathrin assembly protein
Synonymsfit-1, fit1
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location90130213-90213465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90195700 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 567 (I567L)
Ref Sequence ENSEMBL: ENSMUSP00000146386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049537] [ENSMUST00000207084] [ENSMUST00000207225] [ENSMUST00000207484] [ENSMUST00000208730] [ENSMUST00000208742] [ENSMUST00000209068]
Predicted Effect probably benign
Transcript: ENSMUST00000049537
AA Change: I612L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361
AA Change: I612L

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207084
AA Change: I488L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207106
Predicted Effect probably benign
Transcript: ENSMUST00000207225
AA Change: I554L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207484
AA Change: I617L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000208089
AA Change: I334L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208127
Predicted Effect probably benign
Transcript: ENSMUST00000208730
AA Change: I562L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208742
AA Change: I609L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208891
Predicted Effect probably benign
Transcript: ENSMUST00000209068
AA Change: I567L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for different ENU-induced mutations or knock-out alleles are small, runted and display anemia of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Picalm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Picalm APN 7 90161318 missense probably damaging 1.00
IGL01147:Picalm APN 7 90177592 missense probably benign 0.42
IGL02814:Picalm APN 7 90191749 missense possibly damaging 0.75
IGL02828:Picalm APN 7 90177501 missense probably benign
IGL02904:Picalm APN 7 90176411 splice site probably benign
IGL02986:Picalm APN 7 90207585 missense probably benign 0.00
IGL03001:Picalm APN 7 90182246 missense probably benign 0.00
IGL03247:Picalm APN 7 90194291 missense probably benign 0.27
R0024:Picalm UTSW 7 90130704 critical splice donor site probably null
R0085:Picalm UTSW 7 90182317 missense probably benign
R0414:Picalm UTSW 7 90189198 missense possibly damaging 0.94
R0537:Picalm UTSW 7 90130668 missense probably benign 0.14
R0855:Picalm UTSW 7 90191148 missense possibly damaging 0.55
R1269:Picalm UTSW 7 90165549 nonsense probably null
R1496:Picalm UTSW 7 90130651 missense probably benign 0.36
R1635:Picalm UTSW 7 90191251 missense probably damaging 1.00
R1750:Picalm UTSW 7 90191182 missense possibly damaging 0.81
R1755:Picalm UTSW 7 90160549 missense possibly damaging 0.88
R2513:Picalm UTSW 7 90197009 missense probably damaging 1.00
R3850:Picalm UTSW 7 90191704 missense probably damaging 1.00
R3874:Picalm UTSW 7 90189219 missense probably damaging 1.00
R5095:Picalm UTSW 7 90170633 missense probably damaging 1.00
R5368:Picalm UTSW 7 90207595 makesense probably null
R5517:Picalm UTSW 7 90170598 missense possibly damaging 0.68
R6280:Picalm UTSW 7 90177562 missense probably benign 0.00
R6739:Picalm UTSW 7 90176708 missense probably damaging 1.00
R6951:Picalm UTSW 7 90191375 missense probably damaging 1.00
R7083:Picalm UTSW 7 90176768 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCGAGTCTAAGCTTAAGTGGG -3'
(R):5'- GTGGTATCACCTCACTACTTGTAAC -3'

Sequencing Primer
(F):5'- ATTTTGAGATTTTCCTCACTGAGTG -3'
(R):5'- ACATATACAGCAAAGTTATGAGTCG -3'
Posted On2017-06-26