Incidental Mutation 'R6012:Olfr263'
ID479824
Institutional Source Beutler Lab
Gene Symbol Olfr263
Ensembl Gene ENSMUSG00000071522
Gene Nameolfactory receptor 263
SynonymsMOR256-61, GA_x6K02T2QHY8-12114828-12113875, Olfr263-ps1, Olfr42, MOR256-31, IA3, GA_x6K02T2N5E5-9379-8514, MOR256-37P
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21129639-21136296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21132808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000149892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096006] [ENSMUST00000215804]
Predicted Effect probably benign
Transcript: ENSMUST00000096006
AA Change: V11A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093705
Gene: ENSMUSG00000071522
AA Change: V11A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-46 PFAM
Pfam:7tm_1 41 290 4.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215804
AA Change: V11A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Olfr263
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1880:Olfr263 UTSW 13 21133632 missense probably damaging 1.00
R2012:Olfr263 UTSW 13 21133489 missense probably benign 0.13
R3113:Olfr263 UTSW 13 21133129 missense probably damaging 1.00
R4210:Olfr263 UTSW 13 21133437 missense possibly damaging 0.78
R4934:Olfr263 UTSW 13 21133071 missense probably benign
R4952:Olfr263 UTSW 13 21133344 missense probably benign 0.00
R5755:Olfr263 UTSW 13 21133525 missense probably damaging 0.98
R6077:Olfr263 UTSW 13 21133293 missense probably benign 0.02
R6168:Olfr263 UTSW 13 21133229 missense possibly damaging 0.53
R6325:Olfr263 UTSW 13 21133075 missense probably damaging 0.97
R6829:Olfr263 UTSW 13 21132853 missense possibly damaging 0.69
R7130:Olfr263 UTSW 13 21133246 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AACCTAACTTCTTCCACTGCAG -3'
(R):5'- ACCAGCATCTGAGGGACAATG -3'

Sequencing Primer
(F):5'- GCAGCTAATTCTGTATCTTACCAG -3'
(R):5'- GGACAATGCTTGTTGTGAAACAC -3'
Posted On2017-06-26