Incidental Mutation 'R6012:Mfng'
ID479830
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene NameMFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsmanic fringe
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R6012 (G1)
Quality Score152.008
Status Validated
Chromosome15
Chromosomal Location78755882-78773475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78756640 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 302 (R302C)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
PDB Structure
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE [X-RAY DIFFRACTION]
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE IN COMPLEX WITH UDP AND MANGANESE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018313
AA Change: R302C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: R302C

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78764437 missense possibly damaging 0.79
R0504:Mfng UTSW 15 78757314 missense probably benign 0.00
R1905:Mfng UTSW 15 78773086 missense probably damaging 1.00
R3871:Mfng UTSW 15 78756621 missense probably damaging 1.00
R4845:Mfng UTSW 15 78764388 missense probably benign
R4872:Mfng UTSW 15 78764388 missense probably benign
R4874:Mfng UTSW 15 78764388 missense probably benign
R4925:Mfng UTSW 15 78764388 missense probably benign
R4934:Mfng UTSW 15 78764388 missense probably benign
R5006:Mfng UTSW 15 78764388 missense probably benign
R5029:Mfng UTSW 15 78764388 missense probably benign
R5048:Mfng UTSW 15 78764388 missense probably benign
R5064:Mfng UTSW 15 78764388 missense probably benign
R5067:Mfng UTSW 15 78764388 missense probably benign
R5143:Mfng UTSW 15 78764388 missense probably benign
R5145:Mfng UTSW 15 78764388 missense probably benign
R5146:Mfng UTSW 15 78764388 missense probably benign
R5266:Mfng UTSW 15 78764388 missense probably benign
R5969:Mfng UTSW 15 78764382 missense possibly damaging 0.94
R6654:Mfng UTSW 15 78759339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTGTCCATATCGTAGC -3'
(R):5'- GAGGGTCTCAAATCAGGGGTTG -3'

Sequencing Primer
(F):5'- AGCAGTGTCCATATCGTAGCCTTTC -3'
(R):5'- CTCAAATCAGGGGTTGTTTGCCAG -3'
Posted On2017-06-26