Incidental Mutation 'R6012:Glis2'
ID479832
Institutional Source Beutler Lab
Gene Symbol Glis2
Ensembl Gene ENSMUSG00000014303
Gene NameGLIS family zinc finger 2
SynonymsNkl
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4594713-4624924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4611308 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 125 (G125D)
Ref Sequence ENSEMBL: ENSMUSP00000014447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014447] [ENSMUST00000141682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014447
AA Change: G125D

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014447
Gene: ENSMUSG00000014303
AA Change: G125D

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
ZnF_C2H2 168 193 1.05e1 SMART
ZnF_C2H2 202 229 8.09e0 SMART
ZnF_C2H2 235 257 1.82e-3 SMART
ZnF_C2H2 263 287 3.16e-3 SMART
ZnF_C2H2 293 317 1.04e-3 SMART
low complexity region 328 342 N/A INTRINSIC
low complexity region 358 385 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
low complexity region 420 445 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135577
Predicted Effect probably benign
Transcript: ENSMUST00000141682
SMART Domains Protein: ENSMUSP00000115728
Gene: ENSMUSG00000014303

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a fusion allele exhibit decreased kidney weight, kidney atrophy, kidney cysts, and interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Glis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Glis2 APN 16 4611650 missense probably damaging 1.00
IGL01680:Glis2 APN 16 4611331 missense possibly damaging 0.82
IGL02055:Glis2 APN 16 4614108 unclassified probably benign
IGL02802:Glis2 UTSW 16 4611871 critical splice donor site probably null
R0081:Glis2 UTSW 16 4613653 missense probably benign 0.22
R0517:Glis2 UTSW 16 4611552 missense probably damaging 0.98
R2010:Glis2 UTSW 16 4608711 missense probably damaging 0.99
R2145:Glis2 UTSW 16 4613642 missense possibly damaging 0.79
R3780:Glis2 UTSW 16 4613896 unclassified probably benign
R4180:Glis2 UTSW 16 4611376 missense probably benign 0.04
R5213:Glis2 UTSW 16 4614082 unclassified probably benign
R6052:Glis2 UTSW 16 4613739 unclassified probably benign
R6214:Glis2 UTSW 16 4610333 nonsense probably null
R6215:Glis2 UTSW 16 4610333 nonsense probably null
R6316:Glis2 UTSW 16 4613836 unclassified probably benign
X0020:Glis2 UTSW 16 4608653 missense probably damaging 1.00
X0027:Glis2 UTSW 16 4611457 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAACTTTCTGTAGACTTGGCTG -3'
(R):5'- AGGGTTCTGAGCCCAAGTAG -3'

Sequencing Primer
(F):5'- AGACTTGGCTGGCCTTAAGATCTAC -3'
(R):5'- CCAAGTAGGGTGCTGCC -3'
Posted On2017-06-26