Incidental Mutation 'R6012:Abat'
ID479833
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8582827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 97 (Y97N)
Ref Sequence ENSEMBL: ENSMUSP00000111505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115838] [ENSMUST00000115839] [ENSMUST00000138987]
Predicted Effect probably damaging
Transcript: ENSMUST00000065987
AA Change: Y97N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880
AA Change: Y97N

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115838
AA Change: Y97N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111504
Gene: ENSMUSG00000057880
AA Change: Y97N

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 186 5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115839
AA Change: Y97N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880
AA Change: Y97N

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138987
SMART Domains Protein: ENSMUSP00000116686
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 53 232 1.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140795
Predicted Effect probably benign
Transcript: ENSMUST00000144444
SMART Domains Protein: ENSMUSP00000121881
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 3 93 1.3e-19 PFAM
Meta Mutation Damage Score 0.432 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6427:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACATAGAAGCTTGTCAACACC -3'
(R):5'- CAACAATGTCTAATCATGCTGTCTCC -3'

Sequencing Primer
(F):5'- CCACAGATTCCCATGTGGTATAG -3'
(R):5'- AATCATGCTGTCTCCACCATTAC -3'
Posted On2017-06-26