Incidental Mutation 'R6013:Sf3b1'
ID 479836
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Name splicing factor 3b, subunit 1
Synonyms Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4
MMRRC Submission 044189-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6013 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 55024328-55066640 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55039457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 723 (S723T)
Ref Sequence ENSEMBL: ENSMUSP00000027127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027127
AA Change: S723T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: S723T

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187500
Meta Mutation Damage Score 0.2275 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C T 3: 6,682,310 (GRCm39) probably null Het
Aanat A T 11: 116,486,950 (GRCm39) probably null Het
Abca17 A T 17: 24,506,820 (GRCm39) V1178E possibly damaging Het
Abcf3 T A 16: 20,369,311 (GRCm39) probably null Het
Alk A G 17: 72,207,732 (GRCm39) M1001T probably benign Het
Arhgap23 C A 11: 97,391,818 (GRCm39) S1445Y probably damaging Het
Atp10a T C 7: 58,447,538 (GRCm39) I760T probably benign Het
Cadm1 C T 9: 47,768,572 (GRCm39) probably benign Het
Car10 A T 11: 93,076,105 (GRCm39) probably benign Het
Casq2 G T 3: 102,052,945 (GRCm39) probably null Het
Cemip2 G A 19: 21,809,403 (GRCm39) V928I possibly damaging Het
Clec4f T C 6: 83,632,070 (GRCm39) I55V probably benign Het
Cngb1 T C 8: 96,010,949 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,972,098 (GRCm39) probably null Het
Cyp2c39 A C 19: 39,501,969 (GRCm39) R119S probably benign Het
Cyp4f16 C T 17: 32,765,652 (GRCm39) A345V probably null Het
Ddx43 T C 9: 78,321,567 (GRCm39) L412S probably damaging Het
Dnajb12 G A 10: 59,730,163 (GRCm39) probably null Het
Ephx2 A G 14: 66,347,691 (GRCm39) S56P probably benign Het
Fam83h A G 15: 75,875,849 (GRCm39) F496S probably damaging Het
Gcnt4 T C 13: 97,083,786 (GRCm39) S361P possibly damaging Het
H2-T23 G T 17: 36,341,474 (GRCm39) H332Q probably benign Het
Hrob T C 11: 102,145,859 (GRCm39) V45A probably benign Het
Ift57 G T 16: 49,519,667 (GRCm39) probably null Het
Il1rl2 A G 1: 40,391,017 (GRCm39) H320R possibly damaging Het
Kansl1 A G 11: 104,241,465 (GRCm39) V618A probably benign Het
Kctd3 T C 1: 188,728,665 (GRCm39) E157G probably benign Het
Magohb T A 6: 131,270,037 (GRCm39) D31V possibly damaging Het
Mdn1 C A 4: 32,715,713 (GRCm39) F1993L probably damaging Het
Med29 C A 7: 28,086,418 (GRCm39) C130F probably benign Het
Mtmr7 G A 8: 41,034,570 (GRCm39) R251C probably damaging Het
Ncor1 T C 11: 62,211,903 (GRCm39) I49V probably benign Het
Nfkb1 G T 3: 135,332,445 (GRCm39) T109K possibly damaging Het
Pkd1l1 A G 11: 8,819,452 (GRCm39) probably null Het
Pkp1 T A 1: 135,811,648 (GRCm39) T408S probably damaging Het
Plec A T 15: 76,073,510 (GRCm39) D501E possibly damaging Het
Prcp A C 7: 92,576,976 (GRCm39) Y335S possibly damaging Het
Reg2 T A 6: 78,384,952 (GRCm39) Y165N possibly damaging Het
Rnf7 T C 9: 96,353,787 (GRCm39) *114W probably null Het
Scg3 T C 9: 75,584,090 (GRCm39) D137G probably damaging Het
Serpinb7 T C 1: 107,377,919 (GRCm39) V204A probably benign Het
Sez6 C T 11: 77,864,623 (GRCm39) H528Y probably damaging Het
Shtn1 T C 19: 58,963,533 (GRCm39) D594G probably damaging Het
Sptbn4 A G 7: 27,063,904 (GRCm39) L2174P probably damaging Het
Stk25 A G 1: 93,553,181 (GRCm39) probably null Het
Tep1 A T 14: 51,098,505 (GRCm39) F429I probably damaging Het
Thada T A 17: 84,580,228 (GRCm39) I1409F probably benign Het
Usp25 G A 16: 76,873,909 (GRCm39) G495E probably benign Het
Washc2 A G 6: 116,231,114 (GRCm39) S844G probably damaging Het
Xirp2 A T 2: 67,341,287 (GRCm39) H1176L possibly damaging Het
Ypel1 T C 16: 16,918,129 (GRCm39) N96D probably damaging Het
Zfand6 C A 7: 84,281,900 (GRCm39) V110L probably benign Het
Zfp30 A G 7: 29,488,846 (GRCm39) R8G possibly damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 55,026,645 (GRCm39) missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 55,036,090 (GRCm39) splice site probably benign
IGL01380:Sf3b1 APN 1 55,027,108 (GRCm39) missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 55,026,588 (GRCm39) missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55,046,866 (GRCm39) missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55,051,372 (GRCm39) missense probably benign
Colt UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
Glock UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
Handgun UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
Kalashnikov UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
Magazine UTSW 1 55,051,341 (GRCm39) nonsense probably null
Revolver UTSW 1 55,058,548 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0190:Sf3b1 UTSW 1 55,029,465 (GRCm39) missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 55,037,267 (GRCm39) missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55,058,430 (GRCm39) missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55,058,544 (GRCm39) missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55,042,313 (GRCm39) missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55,040,580 (GRCm39) missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55,058,536 (GRCm39) missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55,039,811 (GRCm39) missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 55,037,347 (GRCm39) missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55,046,792 (GRCm39) missense probably benign
R2429:Sf3b1 UTSW 1 55,055,960 (GRCm39) missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 55,038,785 (GRCm39) critical splice donor site probably null
R3772:Sf3b1 UTSW 1 55,039,150 (GRCm39) intron probably benign
R3911:Sf3b1 UTSW 1 55,058,548 (GRCm39) nonsense probably null
R3970:Sf3b1 UTSW 1 55,051,341 (GRCm39) nonsense probably null
R4706:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 55,038,871 (GRCm39) missense probably benign
R5053:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55,042,469 (GRCm39) missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55,042,309 (GRCm39) missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 55,037,334 (GRCm39) missense probably benign 0.27
R5636:Sf3b1 UTSW 1 55,036,352 (GRCm39) missense probably damaging 1.00
R6149:Sf3b1 UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55,046,677 (GRCm39) missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 55,038,814 (GRCm39) missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55,053,640 (GRCm39) critical splice donor site probably null
R7001:Sf3b1 UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
R7302:Sf3b1 UTSW 1 55,055,949 (GRCm39) missense probably benign 0.00
R7644:Sf3b1 UTSW 1 55,036,302 (GRCm39) nonsense probably null
R7664:Sf3b1 UTSW 1 55,026,626 (GRCm39) missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55,042,508 (GRCm39) missense probably benign 0.29
R7809:Sf3b1 UTSW 1 55,034,614 (GRCm39) missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55,051,262 (GRCm39) missense probably null 0.01
R8871:Sf3b1 UTSW 1 55,029,508 (GRCm39) missense probably damaging 1.00
R8947:Sf3b1 UTSW 1 55,039,444 (GRCm39) missense probably damaging 1.00
R9216:Sf3b1 UTSW 1 55,051,376 (GRCm39) missense probably benign 0.00
Z1177:Sf3b1 UTSW 1 55,042,561 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGAATAAGATACCCAATAGCCTTC -3'
(R):5'- CTCACGCAAATTTTGAAATGGGG -3'

Sequencing Primer
(F):5'- TAGCCTTCAAGAAAGCAGCCAG -3'
(R):5'- TTTCTGTTAACAAATTACCATTGCC -3'
Posted On 2017-06-26