Incidental Mutation 'R6013:Serpinb7'
ID479838
Institutional Source Beutler Lab
Gene Symbol Serpinb7
Ensembl Gene ENSMUSG00000067001
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 7
Synonymsmegsin, 4631416M05Rik, ovalbumin
MMRRC Submission 044189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6013 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107399655-107452689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107450189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000083896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086690]
Predicted Effect probably benign
Transcript: ENSMUST00000086690
AA Change: V204A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: V204A

DomainStartEndE-ValueType
SERPIN 13 380 2.7e-121 SMART
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C T 3: 6,617,250 probably null Het
Aanat A T 11: 116,596,124 probably null Het
Abca17 A T 17: 24,287,846 V1178E possibly damaging Het
Abcf3 T A 16: 20,550,561 probably null Het
Alk A G 17: 71,900,737 M1001T probably benign Het
Arhgap23 C A 11: 97,500,992 S1445Y probably damaging Het
Atp10a T C 7: 58,797,790 I760T probably benign Het
BC030867 T C 11: 102,255,033 V45A probably benign Het
Cadm1 C T 9: 47,857,274 probably benign Het
Car10 A T 11: 93,185,279 probably benign Het
Casq2 G T 3: 102,145,629 probably null Het
Clec4f T C 6: 83,655,088 I55V probably benign Het
Cngb1 T C 8: 95,284,321 probably benign Het
Csn1s2b A G 5: 87,824,239 probably null Het
Cyp2c39 A C 19: 39,513,525 R119S probably benign Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Ddx43 T C 9: 78,414,285 L412S probably damaging Het
Dnajb12 G A 10: 59,894,341 probably null Het
Ephx2 A G 14: 66,110,242 S56P probably benign Het
Fam83h A G 15: 76,004,000 F496S probably damaging Het
Gcnt4 T C 13: 96,947,278 S361P possibly damaging Het
H2-T23 G T 17: 36,030,582 H332Q probably benign Het
Ift57 G T 16: 49,699,304 probably null Het
Il1rl2 A G 1: 40,351,857 H320R possibly damaging Het
Kansl1 A G 11: 104,350,639 V618A probably benign Het
Kctd3 T C 1: 188,996,468 E157G probably benign Het
Magohb T A 6: 131,293,074 D31V possibly damaging Het
Mdn1 C A 4: 32,715,713 F1993L probably damaging Het
Med29 C A 7: 28,386,993 C130F probably benign Het
Mtmr7 G A 8: 40,581,528 R251C probably damaging Het
Ncor1 T C 11: 62,321,077 I49V probably benign Het
Nfkb1 G T 3: 135,626,684 T109K possibly damaging Het
Pkd1l1 A G 11: 8,869,452 probably null Het
Pkp1 T A 1: 135,883,910 T408S probably damaging Het
Plec A T 15: 76,189,310 D501E possibly damaging Het
Ppil2 T C 16: 17,100,265 N96D probably damaging Het
Prcp A C 7: 92,927,768 Y335S possibly damaging Het
Reg2 T A 6: 78,407,969 Y165N possibly damaging Het
Rnf7 T C 9: 96,471,734 *114W probably null Het
Scg3 T C 9: 75,676,808 D137G probably damaging Het
Sez6 C T 11: 77,973,797 H528Y probably damaging Het
Sf3b1 A T 1: 55,000,298 S723T probably damaging Het
Shtn1 T C 19: 58,975,101 D594G probably damaging Het
Sptbn4 A G 7: 27,364,479 L2174P probably damaging Het
Stk25 A G 1: 93,625,459 probably null Het
Tep1 A T 14: 50,861,048 F429I probably damaging Het
Thada T A 17: 84,272,800 I1409F probably benign Het
Tmem2 G A 19: 21,832,039 V928I possibly damaging Het
Usp25 G A 16: 77,077,021 G495E probably benign Het
Washc2 A G 6: 116,254,153 S844G probably damaging Het
Xirp2 A T 2: 67,510,943 H1176L possibly damaging Het
Zfand6 C A 7: 84,632,692 V110L probably benign Het
Zfp30 A G 7: 29,789,421 R8G possibly damaging Het
Other mutations in Serpinb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Serpinb7 APN 1 107428246 utr 5 prime probably benign
IGL01325:Serpinb7 APN 1 107435380 missense probably damaging 0.98
IGL01595:Serpinb7 APN 1 107428322 missense probably damaging 0.97
IGL01925:Serpinb7 APN 1 107451669 missense probably benign 0.01
IGL02008:Serpinb7 APN 1 107448129 missense possibly damaging 0.51
IGL02206:Serpinb7 APN 1 107435372 missense possibly damaging 0.88
IGL02870:Serpinb7 APN 1 107450287 missense probably damaging 1.00
IGL03010:Serpinb7 APN 1 107452011 utr 3 prime probably benign
R0455:Serpinb7 UTSW 1 107451610 missense possibly damaging 0.91
R0492:Serpinb7 UTSW 1 107452007 makesense probably null
R0664:Serpinb7 UTSW 1 107428307 missense probably damaging 0.98
R1495:Serpinb7 UTSW 1 107451660 nonsense probably null
R1540:Serpinb7 UTSW 1 107428268 missense possibly damaging 0.72
R1789:Serpinb7 UTSW 1 107450273 missense possibly damaging 0.58
R1850:Serpinb7 UTSW 1 107428295 missense probably damaging 1.00
R2962:Serpinb7 UTSW 1 107451726 missense probably benign 0.00
R3151:Serpinb7 UTSW 1 107435351 nonsense probably null
R3439:Serpinb7 UTSW 1 107428351 missense probably damaging 1.00
R4064:Serpinb7 UTSW 1 107446036 missense probably benign 0.09
R4590:Serpinb7 UTSW 1 107451833 missense probably damaging 1.00
R5260:Serpinb7 UTSW 1 107434749 missense possibly damaging 0.74
R5637:Serpinb7 UTSW 1 107428307 missense probably damaging 1.00
R5914:Serpinb7 UTSW 1 107451850 missense probably damaging 1.00
R5992:Serpinb7 UTSW 1 107445996 missense probably damaging 1.00
R6317:Serpinb7 UTSW 1 107451706 missense probably damaging 1.00
R6494:Serpinb7 UTSW 1 107435346 nonsense probably null
R7181:Serpinb7 UTSW 1 107450322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTAGCTGAAGTTAACTAGCTG -3'
(R):5'- CATAACCGAGAGTATTCTGCACAC -3'

Sequencing Primer
(F):5'- AGCTGAAGTTAACTAGCTGAAATG -3'
(R):5'- CAATAGTCCATTGTAGGGCAACTGTG -3'
Posted On2017-06-26