Incidental Mutation 'R6014:Ap1b1'
ID479928
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
MMRRC Submission 044190-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R6014 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5019364 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 240 (M240K)
Ref Sequence ENSEMBL: ENSMUSP00000105523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect probably benign
Transcript: ENSMUST00000009234
AA Change: M267K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: M267K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101613
AA Change: M240K

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: M240K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109897
AA Change: M240K

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: M240K

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144426
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Arhgap21 C T 2: 20,881,805 G26D probably damaging Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lat2 C T 5: 134,603,454 V142M probably damaging Het
Lemd1 A C 1: 132,256,725 *102S probably null Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ptk2 T G 15: 73,304,444 Y251S possibly damaging Het
Ralgds A G 2: 28,543,661 N219S probably damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Tep1 A T 14: 50,847,000 N907K probably benign Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 5032464 missense probably benign
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R1529:Ap1b1 UTSW 11 5039547 missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 intron probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 5016760 missense probably damaging 1.00
R4710:Ap1b1 UTSW 11 5031664 missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 5026364 missense probably damaging 0.97
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAAGTCATTGGCTGCATAG -3'
(R):5'- GTCTCTAGTACATGGCAAACGTG -3'

Sequencing Primer
(F):5'- GCTGCATAGCCCATCTGG -3'
(R):5'- CATGGCAAACGTGTGGTC -3'
Posted On2017-06-26