Incidental Mutation 'R6025:Dgkz'
ID479955
Institutional Source Beutler Lab
Gene Symbol Dgkz
Ensembl Gene ENSMUSG00000040479
Gene Namediacylglycerol kinase zeta
SynonymsE130307B02Rik, mDGK[z]
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6025 (G1)
Quality Score145.008
Status Not validated
Chromosome2
Chromosomal Location91932824-91975864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91945910 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3 (T3A)
Ref Sequence ENSEMBL: ENSMUSP00000106934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000128152] [ENSMUST00000142090] [ENSMUST00000142231] [ENSMUST00000178895]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111303
AA Change: T3A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479
AA Change: T3A

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126473
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000142090
AA Change: T3A
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000178895
AA Change: V69A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183498
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
PHENOTYPE: The T cell response is enhanced in homozygous mutant mice, which showed a robust response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Dgkz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Dgkz APN 2 91935865 missense probably benign 0.00
IGL01995:Dgkz APN 2 91934050 splice site probably benign
IGL02247:Dgkz APN 2 91937460 missense probably benign 0.00
IGL02573:Dgkz APN 2 91934197 missense probably damaging 0.98
IGL02627:Dgkz APN 2 91938710 splice site probably benign
IGL02903:Dgkz APN 2 91939962 missense possibly damaging 0.45
IGL03106:Dgkz APN 2 91940859 missense probably damaging 0.99
R0103:Dgkz UTSW 2 91934205 missense probably benign
R0312:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R0761:Dgkz UTSW 2 91945351 missense probably benign 0.00
R0839:Dgkz UTSW 2 91935111 missense probably benign 0.00
R1162:Dgkz UTSW 2 91944444 missense probably damaging 1.00
R1223:Dgkz UTSW 2 91939315 splice site probably benign
R1539:Dgkz UTSW 2 91938060 missense probably damaging 1.00
R1934:Dgkz UTSW 2 91937104 missense possibly damaging 0.92
R1936:Dgkz UTSW 2 91937978 missense possibly damaging 0.94
R3438:Dgkz UTSW 2 91934050 splice site probably benign
R3804:Dgkz UTSW 2 91939630 missense probably benign 0.06
R4675:Dgkz UTSW 2 91938346 nonsense probably null
R4731:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4732:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4733:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4901:Dgkz UTSW 2 91936731 missense probably benign
R4972:Dgkz UTSW 2 91945702 missense probably benign 0.00
R5027:Dgkz UTSW 2 91945543 missense probably benign 0.02
R5128:Dgkz UTSW 2 91942683 missense probably damaging 1.00
R5408:Dgkz UTSW 2 91935823 missense possibly damaging 0.91
R5494:Dgkz UTSW 2 91941049 splice site probably null
R5728:Dgkz UTSW 2 91945787 missense possibly damaging 0.93
R5813:Dgkz UTSW 2 91939388 missense possibly damaging 0.50
R6043:Dgkz UTSW 2 91935889 missense probably benign 0.03
R6328:Dgkz UTSW 2 91942635 missense probably benign 0.04
R6335:Dgkz UTSW 2 91944379 missense probably benign 0.16
X0002:Dgkz UTSW 2 91936562 missense probably damaging 0.97
X0021:Dgkz UTSW 2 91937119 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAAACAGCCCTGGAGCTGTG -3'
(R):5'- GGTAGAATTTAGGGAATGCTTGCAG -3'

Sequencing Primer
(F):5'- CTGGAGCTGTGCACTGGAG -3'
(R):5'- GGGAGCAGTGTTTATACTCCAGTAAC -3'
Posted On2017-06-26