Incidental Mutation 'R6025:Duoxa2'
ID479956
Institutional Source Beutler Lab
Gene Symbol Duoxa2
Ensembl Gene ENSMUSG00000027225
Gene Namedual oxidase maturation factor 2
Synonyms
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R6025 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location122298900-122302885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122301851 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000028656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000053734] [ENSMUST00000110537] [ENSMUST00000110538] [ENSMUST00000147788] [ENSMUST00000148417] [ENSMUST00000154412]
Predicted Effect probably benign
Transcript: ENSMUST00000028653
SMART Domains Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 10 287 7.2e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000028656
AA Change: S249P

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225
AA Change: S249P

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053734
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110537
SMART Domains Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 290 3.9e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110538
SMART Domains Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 70 1.7e-23 PFAM
Pfam:DuoxA 67 245 2.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147788
SMART Domains Protein: ENSMUSP00000116280
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 134 5.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148417
SMART Domains Protein: ENSMUSP00000116963
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 210 1.2e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154412
SMART Domains Protein: ENSMUSP00000116911
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 100 6.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155561
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum protein that is necessary for proper cellular localization and maturation of functional dual oxidase 2. Mutations in this gene have been associated with thyroid dyshormonogenesis 5.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Duoxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Duoxa2 APN 2 122300591 missense possibly damaging 0.93
IGL02194:Duoxa2 APN 2 122301849 missense possibly damaging 0.92
R1681:Duoxa2 UTSW 2 122299162 unclassified probably null
R2186:Duoxa2 UTSW 2 122299174 missense probably damaging 1.00
R4062:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4064:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4757:Duoxa2 UTSW 2 122300591 missense possibly damaging 0.93
R4791:Duoxa2 UTSW 2 122301198 missense probably damaging 1.00
R5485:Duoxa2 UTSW 2 122299152 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTCTGGATCATCGCCAATGC -3'
(R):5'- GAGTTTTCATGCAAACCCGG -3'

Sequencing Primer
(F):5'- AATGCGCTGCTCTCCATG -3'
(R):5'- GGGCAAGATACTGAACCCTTCTG -3'
Posted On2017-06-26