Incidental Mutation 'R6025:Lonp2'
ID479978
Institutional Source Beutler Lab
Gene Symbol Lonp2
Ensembl Gene ENSMUSG00000047866
Gene Namelon peptidase 2, peroxisomal
Synonyms1300002A08Rik
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R6025 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location86624043-86723873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86713373 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 247 (G247V)
Ref Sequence ENSEMBL: ENSMUSP00000127938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000121673] [ENSMUST00000122188] [ENSMUST00000155433] [ENSMUST00000163987]
Predicted Effect probably damaging
Transcript: ENSMUST00000034141
AA Change: G667V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: G667V

DomainStartEndE-ValueType
Pfam:LON_substr_bdg 12 220 1e-24 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Pfam:Lon_C 628 837 1.6e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121673
AA Change: G247V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113381
Gene: ENSMUSG00000047866
AA Change: G247V

DomainStartEndE-ValueType
Pfam:AAA 1 93 8.7e-10 PFAM
low complexity region 118 125 N/A INTRINSIC
Pfam:Lon_C 208 417 3.2e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000122188
AA Change: G525V
SMART Domains Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866
AA Change: G525V

DomainStartEndE-ValueType
Pfam:LON 12 224 9e-17 PFAM
AAA 225 370 1.59e-10 SMART
low complexity region 396 403 N/A INTRINSIC
Pfam:Lon_C 486 695 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155433
SMART Domains Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866

DomainStartEndE-ValueType
Pfam:LON 12 220 3.3e-26 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163987
AA Change: G247V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127938
Gene: ENSMUSG00000047866
AA Change: G247V

DomainStartEndE-ValueType
Pfam:AAA 1 93 8.7e-10 PFAM
low complexity region 118 125 N/A INTRINSIC
Pfam:Lon_C 208 417 3.2e-85 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Lonp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Lonp2 APN 8 86633972 missense probably damaging 1.00
IGL00990:Lonp2 APN 8 86641533 splice site probably benign
IGL01654:Lonp2 APN 8 86714086 missense probably damaging 1.00
IGL02021:Lonp2 APN 8 86708971 missense probably benign 0.00
IGL02165:Lonp2 APN 8 86709026 missense probably damaging 1.00
IGL02309:Lonp2 APN 8 86634863 missense probably damaging 1.00
IGL02355:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02362:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02365:Lonp2 APN 8 86716365 missense possibly damaging 0.69
IGL02374:Lonp2 APN 8 86709045 missense probably damaging 0.97
IGL02440:Lonp2 APN 8 86624185 start codon destroyed probably null 0.98
R0083:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0129:Lonp2 UTSW 8 86634890 missense probably damaging 0.99
R0302:Lonp2 UTSW 8 86637991 missense possibly damaging 0.94
R0433:Lonp2 UTSW 8 86633954 missense probably damaging 1.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1413:Lonp2 UTSW 8 86641584 missense probably damaging 1.00
R1589:Lonp2 UTSW 8 86673072 splice site probably benign
R1635:Lonp2 UTSW 8 86713450 missense possibly damaging 0.78
R1654:Lonp2 UTSW 8 86631450 missense probably damaging 0.99
R2033:Lonp2 UTSW 8 86708942 missense possibly damaging 0.77
R2062:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2065:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2066:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2068:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R4321:Lonp2 UTSW 8 86665728 missense probably damaging 1.00
R4713:Lonp2 UTSW 8 86713315 missense probably damaging 0.98
R4750:Lonp2 UTSW 8 86631502 missense probably benign 0.09
R5790:Lonp2 UTSW 8 86631490 missense probably benign 0.24
R5854:Lonp2 UTSW 8 86673071 critical splice donor site probably null
R5884:Lonp2 UTSW 8 86641626 missense probably damaging 1.00
R6236:Lonp2 UTSW 8 86636587 nonsense probably null
R6481:Lonp2 UTSW 8 86634908 missense possibly damaging 0.69
R6534:Lonp2 UTSW 8 86716458 missense probably benign 0.00
R6805:Lonp2 UTSW 8 86709096 missense probably benign
R6983:Lonp2 UTSW 8 86624248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGTCAGAAGTTAGTGCTTAAG -3'
(R):5'- ATGGTGTCATCCTTGTCTCAGAG -3'

Sequencing Primer
(F):5'- GTGCTTAAGTTTGCAGTCTTACAAG -3'
(R):5'- CTCAGAGTTAGTTAGATACTCCCTGG -3'
Posted On2017-06-26