Incidental Mutation 'R6025:Stxbp5'
ID479982
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6025 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9800028 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 616 (T616S)
Ref Sequence ENSEMBL: ENSMUSP00000044535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]
Predicted Effect probably benign
Transcript: ENSMUST00000038213
AA Change: T616S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: T616S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000125200
AA Change: T616S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: T616S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000136324
SMART Domains Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139779
Predicted Effect probably benign
Transcript: ENSMUST00000141722
AA Change: T616S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: T616S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151435
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGTGATGATACAACAAATCCTAAGC -3'
(R):5'- CACCTAGGCATGTGTTCCTG -3'

Sequencing Primer
(F):5'- GGGAATACTCTAAAGAGACTGAG -3'
(R):5'- CCTGTTTACTGCAAGGTCAAAC -3'
Posted On2017-06-26