Incidental Mutation 'R6026:Pikfyve'
ID 480009
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 044198-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6026 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65311856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2031 (V2031A)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: V1986A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: V1986A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: V2031A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: V2031A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Meta Mutation Damage Score 0.7035 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,316,581 (GRCm39) D187G probably benign Het
4933421I07Rik A T 7: 42,095,708 (GRCm39) M180K probably benign Het
Aatk T C 11: 119,903,190 (GRCm39) H345R possibly damaging Het
Abcc8 T C 7: 45,816,424 (GRCm39) T239A probably benign Het
Abcf3 A G 16: 20,369,320 (GRCm39) E234G probably damaging Het
Actrt2 T C 4: 154,751,047 (GRCm39) D363G possibly damaging Het
Adam1a A T 5: 121,657,425 (GRCm39) C623S probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ash1l T C 3: 88,892,326 (GRCm39) Y1402H probably damaging Het
Barhl2 T A 5: 106,603,474 (GRCm39) K228N probably benign Het
Blvrb A G 7: 27,162,115 (GRCm39) H153R probably damaging Het
Capn9 A G 8: 125,332,601 (GRCm39) D480G probably damaging Het
Cct3 T C 3: 88,219,029 (GRCm39) I182T possibly damaging Het
Clasp2 A G 9: 113,740,646 (GRCm39) N1208D probably benign Het
Col26a1 A G 5: 136,876,354 (GRCm39) C89R probably damaging Het
Cops4 T A 5: 100,690,194 (GRCm39) probably benign Het
Cpox T A 16: 58,491,298 (GRCm39) W170R probably damaging Het
Ddx27 A G 2: 166,875,560 (GRCm39) K656E probably benign Het
Eif4e T C 3: 138,256,661 (GRCm39) I66T probably damaging Het
Ercc3 T C 18: 32,378,974 (GRCm39) probably null Het
Esp38 G A 17: 40,266,032 (GRCm39) C47Y probably damaging Het
Fancd2 T C 6: 113,528,731 (GRCm39) V380A possibly damaging Het
Fbxw7 T A 3: 84,859,948 (GRCm39) probably null Het
Fryl T G 5: 73,257,340 (GRCm39) R736S probably benign Het
Gad2 G A 2: 22,513,748 (GRCm39) V62M probably benign Het
Gigyf2 A G 1: 87,368,454 (GRCm39) T1045A probably damaging Het
Gm13090 T A 4: 151,175,157 (GRCm39) L78* probably null Het
Gm19410 G A 8: 36,279,580 (GRCm39) S1815N probably benign Het
Gm28051 A T 12: 102,686,444 (GRCm39) L72Q unknown Het
Gm44511 T C 6: 128,797,240 (GRCm39) T83A possibly damaging Het
Grk2 C T 19: 4,340,811 (GRCm39) V246I probably damaging Het
Grm7 C T 6: 111,478,500 (GRCm39) Q62* probably null Het
Gsdmc3 T A 15: 63,738,600 (GRCm39) E154V probably damaging Het
Gstz1 A C 12: 87,206,948 (GRCm39) Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Hhip A T 8: 80,699,069 (GRCm39) C666S probably damaging Het
Hif1a A C 12: 73,979,055 (GRCm39) H193P probably damaging Het
Hyal2 A G 9: 107,449,398 (GRCm39) T385A probably benign Het
Ihh T C 1: 74,985,886 (GRCm39) T200A probably benign Het
Iqgap3 T A 3: 87,997,478 (GRCm39) V218E probably damaging Het
Lct A G 1: 128,227,755 (GRCm39) I1246T probably benign Het
Lmo7 T C 14: 102,118,426 (GRCm39) V217A probably benign Het
Lrp1 C T 10: 127,409,272 (GRCm39) D1616N probably damaging Het
Lrrfip2 A T 9: 111,043,239 (GRCm39) T165S probably damaging Het
Morc2b A G 17: 33,356,957 (GRCm39) Y272H possibly damaging Het
Muc16 A G 9: 18,571,154 (GRCm39) M455T unknown Het
Ncapg2 A T 12: 116,406,641 (GRCm39) D939V possibly damaging Het
Ncbp3 T C 11: 72,958,548 (GRCm39) V236A probably benign Het
Obscn T A 11: 58,957,916 (GRCm39) T3595S probably damaging Het
Odf2l T C 3: 144,854,797 (GRCm39) S545P possibly damaging Het
Or3a1 T A 11: 74,225,914 (GRCm39) I48F probably damaging Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Pdzrn3 A C 6: 101,339,105 (GRCm39) C269G probably benign Het
Pear1 T A 3: 87,664,220 (GRCm39) N278Y probably damaging Het
Phb1 C T 11: 95,562,245 (GRCm39) R41* probably null Het
Plxna2 A G 1: 194,482,122 (GRCm39) I1465V probably damaging Het
Ppp6r2 A G 15: 89,167,113 (GRCm39) N776S probably benign Het
Prkce A T 17: 86,800,658 (GRCm39) E358V probably benign Het
Prl5a1 A T 13: 28,335,247 (GRCm39) I219F probably benign Het
Prss3 T C 6: 41,354,488 (GRCm39) probably null Het
Ptprc A T 1: 137,998,987 (GRCm39) M858K probably damaging Het
Retreg3 T C 11: 100,997,226 (GRCm39) T85A probably damaging Het
Rfc2 T A 5: 134,624,185 (GRCm39) C265S probably damaging Het
Smarcd1 G T 15: 99,603,619 (GRCm39) V256L probably damaging Het
Stat5a T C 11: 100,771,142 (GRCm39) F574L probably damaging Het
Tcirg1 T C 19: 3,947,487 (GRCm39) H624R probably benign Het
Tcstv1a C A 13: 120,355,987 (GRCm39) probably benign Het
Tenm2 C T 11: 35,963,556 (GRCm39) probably null Het
Tomm40 A G 7: 19,444,889 (GRCm39) V164A probably benign Het
Txnl4a T C 18: 80,250,482 (GRCm39) V26A probably damaging Het
Ugt2a3 A T 5: 87,484,336 (GRCm39) F229L probably benign Het
Utp20 T C 10: 88,604,541 (GRCm39) T1785A probably benign Het
Vmn1r22 T A 6: 57,877,390 (GRCm39) I196L probably benign Het
Zfp652 T G 11: 95,640,788 (GRCm39) C238G possibly damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATGAAAACCTCCTAAAGATGG -3'
(R):5'- TGTGCTCCAAGGACTGTTCC -3'

Sequencing Primer
(F):5'- GATGGTTCGAGACAACCCTCTC -3'
(R):5'- GTTTAATTCTCACAACTGTGGCAC -3'
Posted On 2017-06-26