Incidental Mutation 'R6026:Ptprc'
ID480013
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138071249 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 858 (M858K)
Ref Sequence ENSEMBL: ENSMUSP00000138275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: M882K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: M882K

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182755
AA Change: M858K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: M858K

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183301
AA Change: M1021K

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: M1021K

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Blush UTSW 1 138117720 intron probably benign
chor_muang UTSW 1 138113562 critical splice donor site probably null
crystal UTSW 1 138072255 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
Gentian UTSW 1 138067885 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
ultra UTSW 1 138078445 critical splice donor site probably null
violaceous UTSW 1 138083639 missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
R6995:Ptprc UTSW 1 138088744 missense probably damaging 1.00
R7009:Ptprc UTSW 1 138064553 missense probably damaging 0.97
R7041:Ptprc UTSW 1 138126309 missense probably benign 0.04
R7055:Ptprc UTSW 1 138089571 missense probably damaging 1.00
R7098:Ptprc UTSW 1 138099685 missense probably benign
R7164:Ptprc UTSW 1 138117862 missense probably benign
R7188:Ptprc UTSW 1 138071180 missense probably damaging 1.00
R7191:Ptprc UTSW 1 138101044 missense probably benign 0.02
R7204:Ptprc UTSW 1 138117862 missense probably benign
R7316:Ptprc UTSW 1 138064771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAAGGCAATAACAAGGTGGATTG -3'
(R):5'- GACACTGAACTTTTCTTGGTCTTCAG -3'

Sequencing Primer
(F):5'- AATGCAAGAATAGATAATGGCCCTGC -3'
(R):5'- TGGTCTTCAGAATCTTAACTTTGTC -3'
Posted On2017-06-26