Incidental Mutation 'R6026:Ddx27'
ID480016
Institutional Source Beutler Lab
Gene Symbol Ddx27
Ensembl Gene ENSMUSG00000017999
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Synonyms
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167015193-167034947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167033640 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 656 (K656E)
Ref Sequence ENSEMBL: ENSMUSP00000018143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000048988] [ENSMUST00000067584]
Predicted Effect probably benign
Transcript: ENSMUST00000018143
AA Change: K656E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999
AA Change: K656E

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048988
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000067584
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127468
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein involved in the processing of 5.8S and 28S ribosomal RNAs. More specifically, the encoded protein localizes to the nucleolus, where it interacts with the PeBoW complex to ensure proper 3' end formation of 47S rRNA. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Ddx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ddx27 APN 2 167019966 missense probably benign 0.00
IGL01610:Ddx27 APN 2 167022044 splice site probably benign
IGL01724:Ddx27 APN 2 167028389 missense probably damaging 1.00
IGL02035:Ddx27 APN 2 167029512 missense probably benign 0.00
IGL02141:Ddx27 APN 2 167020523 missense possibly damaging 0.67
IGL02402:Ddx27 APN 2 167015325 utr 5 prime probably benign
IGL02600:Ddx27 APN 2 167026204 missense probably damaging 1.00
IGL02882:Ddx27 APN 2 167027913 missense possibly damaging 0.86
IGL03177:Ddx27 APN 2 167027920 missense possibly damaging 0.76
R1938:Ddx27 UTSW 2 167034109 missense probably damaging 1.00
R2020:Ddx27 UTSW 2 167033771 missense probably damaging 1.00
R2038:Ddx27 UTSW 2 167033755 missense probably damaging 1.00
R2116:Ddx27 UTSW 2 167027764 missense probably benign 0.23
R3103:Ddx27 UTSW 2 167026246 missense probably damaging 1.00
R4524:Ddx27 UTSW 2 167027720 nonsense probably null
R4586:Ddx27 UTSW 2 167019984 missense probably benign 0.00
R4737:Ddx27 UTSW 2 167029299 missense probably benign 0.37
R5350:Ddx27 UTSW 2 167027860 unclassified probably benign
R5568:Ddx27 UTSW 2 167029519 missense possibly damaging 0.78
R5573:Ddx27 UTSW 2 167017886 missense possibly damaging 0.87
R5606:Ddx27 UTSW 2 167019966 missense probably benign 0.00
R6699:Ddx27 UTSW 2 167020503 missense possibly damaging 0.92
R6845:Ddx27 UTSW 2 167022096 missense probably damaging 1.00
R6941:Ddx27 UTSW 2 167015377 missense possibly damaging 0.93
R7246:Ddx27 UTSW 2 167020517 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTACTTTACTCAGTGAGCTG -3'
(R):5'- TCACTTACCAGGGCCTGTAG -3'

Sequencing Primer
(F):5'- GTGAGCTGTCACCTCTAGTTC -3'
(R):5'- TAGGCTCGTCCTCAGGCATTG -3'
Posted On2017-06-26