Incidental Mutation 'R6026:Eif4e'
ID480023
Institutional Source Beutler Lab
Gene Symbol Eif4e
Ensembl Gene ENSMUSG00000028156
Gene Nameeukaryotic translation initiation factor 4E
SynonymsIf4e, eIF-4E
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138526179-138559696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138550900 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 66 (I66T)
Ref Sequence ENSEMBL: ENSMUSP00000143772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029803] [ENSMUST00000196990] [ENSMUST00000200020] [ENSMUST00000200100] [ENSMUST00000200239]
Predicted Effect probably damaging
Transcript: ENSMUST00000029803
AA Change: I98T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029803
Gene: ENSMUSG00000028156
AA Change: I98T

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 199 8.7e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196990
AA Change: I13T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143104
Gene: ENSMUSG00000028156
AA Change: I13T

DomainStartEndE-ValueType
Pfam:IF4E 1 115 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198252
Predicted Effect probably damaging
Transcript: ENSMUST00000200020
AA Change: I98T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143690
Gene: ENSMUSG00000028156
AA Change: I98T

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 183 1.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200100
AA Change: I66T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143772
Gene: ENSMUSG00000028156
AA Change: I66T

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 31 167 3.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200239
SMART Domains Protein: ENSMUSP00000143481
Gene: ENSMUSG00000028156

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 79 5.4e-9 PFAM
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. It has also been associated with autism spectrum disorders. Consistently, knockout of this gene results in increased translation of neuroligins, postsynaptic proteins linked to autism spectrum disorders. Pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit resistance to developing prostate intraepithelial neoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Eif4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Eif4e APN 3 138547651 splice site probably benign
IGL03328:Eif4e APN 3 138553727 intron probably benign
R1398:Eif4e UTSW 3 138546375 missense probably damaging 0.99
R2010:Eif4e UTSW 3 138555458 missense probably benign 0.08
R3925:Eif4e UTSW 3 138555437 missense probably damaging 1.00
R7038:Eif4e UTSW 3 138527182 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTCGGGAATTTTCAGAAC -3'
(R):5'- AAGGGCTTCTTTAGAACAGGG -3'

Sequencing Primer
(F):5'- CTCGGGAATTTTCAGAACCTTTAGG -3'
(R):5'- CTTCTTTAGAACAGGGGCTGTAAG -3'
Posted On2017-06-26