Incidental Mutation 'R6026:Actrt2'
ID480026
Institutional Source Beutler Lab
Gene Symbol Actrt2
Ensembl Gene ENSMUSG00000051276
Gene Nameactin-related protein T2
SynonymsArpm2, 1700052K15Rik, Arp-T2
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6026 (G1)
Quality Score137.008
Status Validated
Chromosome4
Chromosomal Location154666433-154667867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154666590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 363 (D363G)
Ref Sequence ENSEMBL: ENSMUSP00000050377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060062]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060062
AA Change: D363G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050377
Gene: ENSMUSG00000051276
AA Change: D363G

DomainStartEndE-ValueType
ACTIN 9 377 1.01e-146 SMART
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the actin family. Studies have shown that this protein may be involved in cytoskeletal organization similar to other cytoplasmic actin-related protein (ARP) subfamily members. Antibody raised against the human protein has been used to detect the protein by immunoblotting and immunofluorescence microscopy, demonstrating its specific synthesis in the testis, late in spermatid differentiation, and its localization in the calyx. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Actrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Actrt2 APN 4 154666705 missense probably benign 0.01
IGL02323:Actrt2 APN 4 154666798 missense probably benign 0.00
R0526:Actrt2 UTSW 4 154667412 missense probably damaging 1.00
R1567:Actrt2 UTSW 4 154666914 missense possibly damaging 0.55
R2120:Actrt2 UTSW 4 154667094 missense probably benign 0.01
R4322:Actrt2 UTSW 4 154667244 missense probably damaging 0.99
R4623:Actrt2 UTSW 4 154667290 missense probably benign
R4824:Actrt2 UTSW 4 154666887 missense probably damaging 1.00
R5253:Actrt2 UTSW 4 154667569 missense possibly damaging 0.45
R5880:Actrt2 UTSW 4 154667290 missense probably benign
R6763:Actrt2 UTSW 4 154667379 missense probably damaging 0.96
R7247:Actrt2 UTSW 4 154667423 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AAAGAATGGAGTCTGCCACG -3'
(R):5'- ACAGAAGACACTCTTTGGGG -3'

Sequencing Primer
(F):5'- AGTCTGCCACGGTCAAGTGTATC -3'
(R):5'- AAGACACTCTTTGGGGAGATTG -3'
Posted On2017-06-26