Incidental Mutation 'R6026:Col26a1'
ID480033
Institutional Source Beutler Lab
Gene Symbol Col26a1
Ensembl Gene ENSMUSG00000004415
Gene Namecollagen, type XXVI, alpha 1
SynonymsCol26a1, Collagen XXVI, Emu2
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R6026 (G1)
Quality Score121.008
Status Validated
Chromosome5
Chromosomal Location136741759-136883209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136847500 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 89 (C89R)
Ref Sequence ENSEMBL: ENSMUSP00000106732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057497] [ENSMUST00000111103]
Predicted Effect probably damaging
Transcript: ENSMUST00000057497
AA Change: C89R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052095
Gene: ENSMUSG00000004415
AA Change: C89R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:EMI 53 123 5.6e-21 PFAM
low complexity region 143 157 N/A INTRINSIC
Pfam:Collagen 189 252 2e-10 PFAM
Pfam:Collagen 217 273 8.4e-9 PFAM
low complexity region 302 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111103
AA Change: C89R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106732
Gene: ENSMUSG00000004415
AA Change: C89R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:EMI 52 123 1.2e-27 PFAM
low complexity region 141 155 N/A INTRINSIC
Pfam:Collagen 187 250 2.1e-10 PFAM
Pfam:Collagen 215 271 8.6e-9 PFAM
Pfam:Collagen 298 335 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173496
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an emilin domain and two collagen stretches. This gene may be associated with aspirin-intolerant asthma. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Col26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Col26a1 APN 5 136754339 nonsense probably null
IGL03028:Col26a1 APN 5 136743118 missense possibly damaging 0.78
IGL03144:Col26a1 APN 5 136765348 missense probably damaging 0.99
PIT4514001:Col26a1 UTSW 5 136751725 missense probably benign
R0454:Col26a1 UTSW 5 136754193 missense probably benign 0.01
R0833:Col26a1 UTSW 5 136765300 critical splice donor site probably null
R0836:Col26a1 UTSW 5 136765300 critical splice donor site probably null
R1187:Col26a1 UTSW 5 136744166 missense probably damaging 0.99
R1236:Col26a1 UTSW 5 136754926 missense probably benign
R4646:Col26a1 UTSW 5 136847550 missense probably damaging 1.00
R4804:Col26a1 UTSW 5 136836725 missense probably damaging 0.99
R5772:Col26a1 UTSW 5 136847566 nonsense probably null
R6481:Col26a1 UTSW 5 136744178 missense probably benign 0.45
R6919:Col26a1 UTSW 5 136744234 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGGGCAGCTCTAAAACCTAG -3'
(R):5'- TACACTGTCCCTGGGCCATC -3'

Sequencing Primer
(F):5'- GGGGCAGCTCTAAAACCTAGATTTC -3'
(R):5'- CCTGGGCCATCTGGGAAC -3'
Posted On2017-06-26