Incidental Mutation 'R6026:Hhip'
ID480045
Institutional Source Beutler Lab
Gene Symbol Hhip
Ensembl Gene ENSMUSG00000064325
Gene NameHedgehog-interacting protein
SynonymsHip, Hhip1, Hip1
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location79965851-80058006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79972440 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 666 (C666S)
Ref Sequence ENSEMBL: ENSMUSP00000078047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079038]
Predicted Effect probably damaging
Transcript: ENSMUST00000079038
AA Change: C666S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: C666S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Folate_rec 38 220 4.9e-26 PFAM
Pfam:GSDH 226 444 3e-22 PFAM
EGF 593 635 9.63e0 SMART
EGF 638 667 2.35e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183628
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Hhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Hhip APN 8 79996783 missense probably damaging 0.96
IGL02560:Hhip APN 8 79987009 missense probably damaging 0.98
IGL03046:Hhip UTSW 8 79972338 missense probably damaging 0.99
R0068:Hhip UTSW 8 79989256 missense probably damaging 1.00
R0356:Hhip UTSW 8 79997492 missense probably benign 0.20
R0707:Hhip UTSW 8 79998255 missense probably damaging 1.00
R1163:Hhip UTSW 8 79992476 missense probably damaging 1.00
R1583:Hhip UTSW 8 79990276 missense probably damaging 1.00
R1900:Hhip UTSW 8 79975046 missense probably benign 0.15
R2071:Hhip UTSW 8 80057302 missense probably benign 0.00
R2255:Hhip UTSW 8 80045181 missense probably damaging 0.98
R3847:Hhip UTSW 8 79997495 missense probably benign 0.00
R4012:Hhip UTSW 8 79992594 missense probably damaging 1.00
R4448:Hhip UTSW 8 80043945 critical splice donor site probably null
R4607:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4608:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4677:Hhip UTSW 8 80045097 missense probably damaging 0.96
R4738:Hhip UTSW 8 79992570 missense probably damaging 0.98
R5040:Hhip UTSW 8 79997606 missense probably benign 0.00
R5371:Hhip UTSW 8 79997591 missense probably damaging 0.98
R5594:Hhip UTSW 8 79996863 missense probably damaging 1.00
R5785:Hhip UTSW 8 79998192 missense possibly damaging 0.84
R6259:Hhip UTSW 8 79972404 missense probably damaging 1.00
R6782:Hhip UTSW 8 80051604 missense probably damaging 1.00
R7105:Hhip UTSW 8 79975009 missense probably benign 0.04
R7134:Hhip UTSW 8 79992513 missense probably benign
R7238:Hhip UTSW 8 79987012 missense probably benign
X0026:Hhip UTSW 8 79992560 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTAGCAGAAGGACAGTCTCTC -3'
(R):5'- TGTCTGCAAACCGTTTACGTAC -3'

Sequencing Primer
(F):5'- GGACAGTCTCTCTTTTTAATGATGAC -3'
(R):5'- ACGTACTTAGATATTCTCTGTCCAG -3'
Posted On2017-06-26