Incidental Mutation 'R6026:Hyal2'
ID480049
Institutional Source Beutler Lab
Gene Symbol Hyal2
Ensembl Gene ENSMUSG00000010047
Gene Namehyaluronoglucosaminidase 2
Synonyms
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107567945-107572779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107572199 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 385 (T385A)
Ref Sequence ENSEMBL: ENSMUSP00000141280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010191] [ENSMUST00000010195] [ENSMUST00000112387] [ENSMUST00000123005] [ENSMUST00000144392] [ENSMUST00000192887] [ENSMUST00000193747] [ENSMUST00000194794] [ENSMUST00000195681] [ENSMUST00000195752]
Predicted Effect probably benign
Transcript: ENSMUST00000010191
AA Change: T385A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000010191
Gene: ENSMUSG00000010047
AA Change: T385A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 29 362 9.6e-140 PFAM
EGF 364 439 4.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010195
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112387
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123005
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144392
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181099
Predicted Effect probably benign
Transcript: ENSMUST00000192887
SMART Domains Protein: ENSMUSP00000142207
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 82 5.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193747
SMART Domains Protein: ENSMUSP00000142141
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 342 5.4e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194794
SMART Domains Protein: ENSMUSP00000142019
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 154 8.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195667
Predicted Effect probably benign
Transcript: ENSMUST00000195681
SMART Domains Protein: ENSMUSP00000141820
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 325 3.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195752
AA Change: T385A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141280
Gene: ENSMUSG00000010047
AA Change: T385A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 363 1.1e-144 PFAM
EGF 364 439 4.26e0 SMART
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, poor survival, craniofacial defects, and mild anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Hyal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Hyal2 APN 9 107570405 missense probably damaging 1.00
IGL00337:Hyal2 APN 9 107572172 missense probably damaging 1.00
IGL01834:Hyal2 APN 9 107570906 missense probably damaging 1.00
IGL02469:Hyal2 APN 9 107572212 missense probably damaging 1.00
R0505:Hyal2 UTSW 9 107572071 missense probably benign 0.28
R1078:Hyal2 UTSW 9 107572246 missense probably benign
R1543:Hyal2 UTSW 9 107570187 missense probably damaging 0.98
R1858:Hyal2 UTSW 9 107572338 missense probably benign 0.01
R1974:Hyal2 UTSW 9 107572172 missense probably damaging 1.00
R3842:Hyal2 UTSW 9 107572121 missense probably damaging 0.99
R4400:Hyal2 UTSW 9 107570853 missense probably damaging 1.00
R5111:Hyal2 UTSW 9 107571111 missense probably benign 0.00
R5922:Hyal2 UTSW 9 107570907 missense probably damaging 1.00
R6266:Hyal2 UTSW 9 107570715 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCGCTATCACCACAGTTTCC -3'
(R):5'- TTATAGTTCCGTTGGCACTGC -3'

Sequencing Primer
(F):5'- CTTGGGCAAAGGTAGCTAACATC -3'
(R):5'- TTGGCACTGCTCGCCAC -3'
Posted On2017-06-26