Incidental Mutation 'R6026:Lmo7'
ID480069
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101880990 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 217 (V217A)
Ref Sequence ENSEMBL: ENSMUSP00000097910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect probably benign
Transcript: ENSMUST00000100337
AA Change: V217A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: V217A

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159026
SMART Domains Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159258
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159314
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159597
AA Change: V95A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: V95A

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159797
Predicted Effect unknown
Transcript: ENSMUST00000159806
AA Change: V50A
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060
AA Change: V50A

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162091
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTGCCTGAAAAGAAGTG -3'
(R):5'- AGTCCCAATGAGCCAGGAAC -3'

Sequencing Primer
(F):5'- CCTGAAAAGAAGTGGCCGG -3'
(R):5'- TGAGCCAGGAACCATCTCCTC -3'
Posted On2017-06-26