Incidental Mutation 'R6026:Smarcd1'
ID480072
Institutional Source Beutler Lab
Gene Symbol Smarcd1
Ensembl Gene ENSMUSG00000023018
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
SynonymsD15Kz1, Baf60a
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99702129-99713991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99705738 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 256 (V256L)
Ref Sequence ENSEMBL: ENSMUSP00000023759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000023759] [ENSMUST00000163472] [ENSMUST00000228984] [ENSMUST00000229236] [ENSMUST00000229845] [ENSMUST00000230530]
PDB Structure
Solution structure of the SWIB domain of mouse BRG1-associated factor 60a [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000023759
AA Change: V256L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018
AA Change: V256L

DomainStartEndE-ValueType
low complexity region 9 38 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Blast:KISc 124 271 2e-43 BLAST
SWIB 291 370 1.97e-35 SMART
Blast:MYSc 452 498 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163472
SMART Domains Protein: ENSMUSP00000128823
Gene: ENSMUSG00000091604

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
low complexity region 44 78 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect probably benign
Transcript: ENSMUST00000228984
Predicted Effect possibly damaging
Transcript: ENSMUST00000229236
AA Change: V215L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229686
Predicted Effect probably benign
Transcript: ENSMUST00000229845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230504
Predicted Effect probably benign
Transcript: ENSMUST00000230530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230748
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Smarcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Smarcd1 APN 15 99712213 missense probably benign 0.10
IGL01714:Smarcd1 APN 15 99712421 missense probably damaging 1.00
IGL02488:Smarcd1 APN 15 99711201 missense possibly damaging 0.83
P0021:Smarcd1 UTSW 15 99712361 splice site probably benign
R0597:Smarcd1 UTSW 15 99711094 missense probably damaging 1.00
R0645:Smarcd1 UTSW 15 99707386 unclassified probably null
R1531:Smarcd1 UTSW 15 99707383 missense probably damaging 1.00
R1661:Smarcd1 UTSW 15 99707638 critical splice acceptor site probably null
R1857:Smarcd1 UTSW 15 99709414 missense probably damaging 0.97
R3003:Smarcd1 UTSW 15 99712184 missense probably damaging 1.00
R4170:Smarcd1 UTSW 15 99707931 missense probably damaging 1.00
R4964:Smarcd1 UTSW 15 99707981 missense possibly damaging 0.79
R5116:Smarcd1 UTSW 15 99702488 missense probably benign 0.00
R5358:Smarcd1 UTSW 15 99703247 nonsense probably null
R5559:Smarcd1 UTSW 15 99703295 critical splice donor site probably null
R6424:Smarcd1 UTSW 15 99704367 missense probably damaging 1.00
R6450:Smarcd1 UTSW 15 99707885 missense possibly damaging 0.85
R7126:Smarcd1 UTSW 15 99709325 missense probably damaging 1.00
X0026:Smarcd1 UTSW 15 99702449 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CATCCTGGGGACTTCTTTCTGG -3'
(R):5'- CGTCAGTTACTACAGCCCAC -3'

Sequencing Primer
(F):5'- CTGGCCTTGTGTAACAACAC -3'
(R):5'- CAGTTGAAAGTGTAAGGACTCCACTC -3'
Posted On2017-06-26