Incidental Mutation 'R6026:Ercc3'
ID480078
Institutional Source Beutler Lab
Gene Symbol Ercc3
Ensembl Gene ENSMUSG00000024382
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 3
SynonymsXPB
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location32240300-32270151 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 32245921 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025241]
Predicted Effect probably null
Transcript: ENSMUST00000025241
SMART Domains Protein: ENSMUSP00000025241
Gene: ENSMUSG00000024382

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:Helicase_C_3 76 203 1.2e-46 PFAM
DEXDc 313 493 2.52e-18 SMART
HELICc 570 648 4.32e-8 SMART
low complexity region 707 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142213
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ATP-dependent DNA helicase that functions in nucleotide excision repair. The encoded protein is a subunit of basal transcription factor 2 (TFIIH) and, therefore, also functions in class II transcription. Mutations in this gene are associated with Xeroderma pigmentosum B, Cockayne's syndrome, and trichothiodystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a frame shift mutation in exon 15 exhibit embryonic lethality prior to E8.5. Mice homozygous for a frame shift mutation following by a stop codon insertion in exon 15 exhibit increased sensitivity to ultraviolet- and gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Ercc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Ercc3 APN 18 32264545 splice site probably benign
IGL01108:Ercc3 APN 18 32264585 missense probably damaging 0.99
IGL01131:Ercc3 APN 18 32269889 makesense probably null
IGL01541:Ercc3 APN 18 32248319 missense possibly damaging 0.87
IGL01959:Ercc3 APN 18 32257358 missense probably damaging 1.00
IGL02862:Ercc3 APN 18 32243202 critical splice donor site probably null
IGL03107:Ercc3 APN 18 32248307 missense possibly damaging 0.95
IGL03334:Ercc3 APN 18 32240837 critical splice donor site probably null
PIT4651001:Ercc3 UTSW 18 32240312 unclassified probably benign
R0545:Ercc3 UTSW 18 32245902 missense probably damaging 1.00
R0561:Ercc3 UTSW 18 32245539 missense possibly damaging 0.85
R1159:Ercc3 UTSW 18 32264558 missense possibly damaging 0.86
R1496:Ercc3 UTSW 18 32261297 splice site probably benign
R1733:Ercc3 UTSW 18 32267165 missense possibly damaging 0.60
R1943:Ercc3 UTSW 18 32246610 missense probably damaging 1.00
R2013:Ercc3 UTSW 18 32248429 missense probably benign
R2015:Ercc3 UTSW 18 32248429 missense probably benign
R2303:Ercc3 UTSW 18 32245547 missense probably benign 0.08
R4393:Ercc3 UTSW 18 32265621 missense probably benign 0.00
R4600:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4601:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4602:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4603:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4796:Ercc3 UTSW 18 32248310 missense probably damaging 1.00
R4957:Ercc3 UTSW 18 32243117 missense probably damaging 1.00
R5253:Ercc3 UTSW 18 32269864 missense probably damaging 0.97
R5265:Ercc3 UTSW 18 32254243 missense probably damaging 0.99
R5342:Ercc3 UTSW 18 32245595 missense probably benign 0.01
R5455:Ercc3 UTSW 18 32267209 missense possibly damaging 0.89
R5639:Ercc3 UTSW 18 32265714 missense probably damaging 0.99
R5702:Ercc3 UTSW 18 32254153 missense probably damaging 0.99
R6053:Ercc3 UTSW 18 32246754 missense probably damaging 1.00
R6650:Ercc3 UTSW 18 32261336 missense probably damaging 1.00
R7150:Ercc3 UTSW 18 32257272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGCAGAGTCTGGATTCC -3'
(R):5'- TCTGAACCAAAATGGATCCTATGGAG -3'

Sequencing Primer
(F):5'- TTTCTCTCACAGATTTCTAAGACGG -3'
(R):5'- ATCCTATGGAGAGCAGCTTCCTAG -3'
Posted On2017-06-26