Incidental Mutation 'R6029:Sis'
ID480237
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission 044201-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6029 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72928308 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 907 (T907I)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect probably benign
Transcript: ENSMUST00000094190
AA Change: T907I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: T907I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167334
AA Change: T907I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: T907I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,694,026 probably null Het
4933402N22Rik A T 5: 11,920,713 L84F probably damaging Het
9930021J03Rik A G 19: 29,754,967 probably benign Het
Adi1 G A 12: 28,679,319 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Apob A G 12: 8,016,243 E4371G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,480,990 C2538W possibly damaging Het
Btbd16 T C 7: 130,819,072 V353A probably benign Het
Cad C T 5: 31,054,983 S10L possibly damaging Het
Cdc42bpa T C 1: 180,111,787 S877P probably damaging Het
Cep152 A T 2: 125,563,632 V1660D probably benign Het
Clrn2 G T 5: 45,460,186 G133V probably damaging Het
Clstn2 T C 9: 97,456,581 I842V probably benign Het
Cpt1c C T 7: 44,965,124 A434T probably benign Het
D130052B06Rik G T 11: 33,623,477 V70L possibly damaging Het
Dlg1 T A 16: 31,793,570 V317E probably damaging Het
Dock10 T C 1: 80,536,946 E1084G possibly damaging Het
Dync2h1 A G 9: 7,157,646 V827A probably benign Het
E030030I06Rik A G 10: 22,148,933 L27P unknown Het
Ero1lb T A 13: 12,574,833 L39Q probably damaging Het
Erp27 T C 6: 136,911,611 D123G probably damaging Het
Fasn G T 11: 120,820,909 F148L probably damaging Het
Fbxl5 T C 5: 43,765,404 E218G probably damaging Het
Fbxw28 A T 9: 109,329,425 D210E probably damaging Het
Gm10653 T A 9: 62,841,514 probably benign Het
Gm17067 A G 7: 42,708,130 L316S probably benign Het
Gm29106 T C 1: 118,200,260 S561P probably damaging Het
H2afy2 T C 10: 61,747,762 T200A possibly damaging Het
Hmcn1 C A 1: 150,632,437 K3699N probably benign Het
Itch T A 2: 155,179,089 probably null Het
Itpr3 C T 17: 27,098,171 A800V probably damaging Het
Kdm2b A T 5: 122,879,587 M1052K probably damaging Het
Kdm4b T C 17: 56,396,576 M712T probably damaging Het
Kmt5b A G 19: 3,802,104 E137G probably damaging Het
Krt33a G A 11: 100,012,463 T251I probably benign Het
Lrrc4b G T 7: 44,462,330 R542L probably benign Het
Macf1 C A 4: 123,507,333 S653I probably damaging Het
Macrod2 G A 2: 142,318,447 V408M probably damaging Het
Mapkapk3 G T 9: 107,289,226 A40E possibly damaging Het
Mmp20 G A 9: 7,639,301 V157I probably benign Het
Mrps28 T C 3: 8,923,745 R18G possibly damaging Het
Msrb2 T A 2: 19,394,311 C162S probably damaging Het
Nat6 A G 9: 107,583,554 Y216C probably damaging Het
Nckap5 T G 1: 126,025,786 T1078P possibly damaging Het
Nectin3 T C 16: 46,436,400 Y91C probably benign Het
Nf2 G T 11: 4,784,566 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1209 T C 2: 88,910,036 D119G probably damaging Het
Olfr1288 T A 2: 111,478,965 Y60* probably null Het
Olfr1380 A T 11: 49,564,601 I227F possibly damaging Het
Olfr149 G A 9: 39,702,400 A123V probably damaging Het
Olfr537-ps1 A T 7: 140,538,876 M120L unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxr1 T G 15: 41,825,901 L507W probably damaging Het
Plxna2 A G 1: 194,794,427 M1184V probably benign Het
Plxna2 A T 1: 194,799,575 K1451M probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Ppp1r16b T C 2: 158,755,217 V257A possibly damaging Het
Prss56 G A 1: 87,187,557 W498* probably null Het
Ptpru A G 4: 131,771,293 F1329S probably damaging Het
Pusl1 A G 4: 155,889,463 F278S probably damaging Het
Qars A T 9: 108,513,690 L470F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rora T A 9: 69,364,452 N181K probably benign Het
Rufy3 A G 5: 88,627,255 D262G probably damaging Het
Sh3gl2 G A 4: 85,381,414 V212M probably damaging Het
Slc38a3 A T 9: 107,652,175 I456N probably damaging Het
Slc4a8 T A 15: 100,807,339 C809S probably benign Het
Snap91 A T 9: 86,825,080 probably null Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Spry1 T C 3: 37,642,848 I80T possibly damaging Het
St8sia2 A G 7: 73,960,710 L275P possibly damaging Het
Supt7l C A 5: 31,526,987 probably null Het
Tdo2 T A 3: 81,961,440 K304N probably damaging Het
Tdrd12 A T 7: 35,485,230 Y753N probably damaging Het
Topbp1 A T 9: 103,344,953 Q1341L probably benign Het
Trim14 G T 4: 46,506,998 A406E probably benign Het
Trp63 C T 16: 25,868,214 R393W probably damaging Het
Trrap T C 5: 144,817,679 V1932A possibly damaging Het
Trrap T C 5: 144,825,914 M2399T possibly damaging Het
Unc45b A G 11: 82,913,327 N110S probably damaging Het
Usp32 G T 11: 85,025,582 H845Q probably damaging Het
Usp44 G A 10: 93,846,632 D268N probably damaging Het
Vmn1r18 T G 6: 57,390,466 R34S possibly damaging Het
Vmn2r103 T A 17: 19,794,216 Y423* probably null Het
Wapl A T 14: 34,739,247 E1054V possibly damaging Het
Zbtb8b A G 4: 129,428,493 Y392H probably damaging Het
Zdhhc2 A T 8: 40,472,927 Q321L probably null Het
Zfp983 A G 17: 21,662,485 D443G probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 synonymous probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCACCTTGTCAGTCATCTG -3'
(R):5'- CTCATTTTGGAGCTCTAAATGCAC -3'

Sequencing Primer
(F):5'- GTCAGTCATCTGCTATACAATGTC -3'
(R):5'- GACTCCTAAAAATTCCGTTTG -3'
Posted On2017-06-26