Incidental Mutation 'R0513:Myo18a'
ID48034
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Namemyosin XVIIIA
SynonymsMyoPDZ
MMRRC Submission 038707-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0513 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77763246-77865980 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 77811594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000130627] [ENSMUST00000151373] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000168348] [ENSMUST00000169105] [ENSMUST00000172303]
Predicted Effect probably benign
Transcript: ENSMUST00000000645
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092884
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092887
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100794
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102488
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108375
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108376
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130305
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130627
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151373
SMART Domains Protein: ENSMUSP00000123256
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
Blast:MYSc 45 89 3e-19 BLAST
low complexity region 90 105 N/A INTRINSIC
internal_repeat_1 115 134 4.34e-5 PROSPERO
low complexity region 135 164 N/A INTRINSIC
internal_repeat_1 188 209 4.34e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000164334
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167856
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168348
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169105
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172303
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 99% (122/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,659 T146A probably benign Het
4930452B06Rik A C 14: 8,536,609 D199E probably damaging Het
5830473C10Rik A T 5: 90,577,927 T333S probably benign Het
6720489N17Rik A C 13: 62,605,215 V99G possibly damaging Het
Abcg4 A G 9: 44,281,687 S121P possibly damaging Het
Actr2 T C 11: 20,080,124 T212A probably damaging Het
Adcy10 T A 1: 165,519,519 D368E probably benign Het
Anapc15 T C 7: 101,898,540 probably benign Het
Aox4 A G 1: 58,217,519 R67G probably benign Het
Aox4 A G 1: 58,247,300 D697G probably damaging Het
Arhgap42 A T 9: 9,005,765 S755T probably benign Het
Atm A G 9: 53,503,948 V881A probably benign Het
Cd163l1 C A 7: 140,224,960 C625* probably null Het
Cdkal1 C T 13: 29,625,965 probably benign Het
Cfap61 C A 2: 146,035,295 N491K possibly damaging Het
Chgb T C 2: 132,785,977 probably benign Het
Chrna1 C A 2: 73,568,082 probably benign Het
Chst10 A G 1: 38,865,763 L283P probably damaging Het
Clca3a1 A G 3: 144,760,562 probably null Het
Cryzl1 G T 16: 91,699,287 A1E possibly damaging Het
Csnk1a1 T C 18: 61,576,547 Y213H probably damaging Het
Cspg4 A G 9: 56,898,091 Q2062R probably benign Het
Ctnnal1 A G 4: 56,835,348 C310R probably benign Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
D930048N14Rik T C 11: 51,654,928 probably benign Het
Dag1 G A 9: 108,208,485 P486S possibly damaging Het
Dgkq A G 5: 108,656,495 L33P probably benign Het
Dlc1 C T 8: 36,584,010 G856R probably damaging Het
Dst T A 1: 34,219,531 probably benign Het
Dtl A T 1: 191,569,707 Y79* probably null Het
Egfr T G 11: 16,872,855 L406R probably damaging Het
Elp3 A T 14: 65,563,246 probably null Het
Fbxw19 C A 9: 109,481,553 probably null Het
Frs2 T C 10: 117,074,665 E264G possibly damaging Het
Fscn2 G T 11: 120,361,880 V58L probably damaging Het
Gm17324 G A 9: 78,448,725 probably benign Het
Gm4787 A T 12: 81,378,312 N357K probably benign Het
Gm9956 G T 10: 56,745,195 Het
Gsg1l C T 7: 126,020,623 probably null Het
Herc1 G A 9: 66,445,645 V2138M possibly damaging Het
Htr2a T C 14: 74,706,324 L448P probably benign Het
Ing3 C T 6: 21,970,035 S255L probably damaging Het
Ispd A T 12: 36,390,468 H125L probably damaging Het
Krt78 T C 15: 101,950,949 D271G probably damaging Het
Lmbrd2 T A 15: 9,194,729 L606H probably damaging Het
Lmod1 T A 1: 135,325,168 N53K probably damaging Het
Lsr G C 7: 30,958,338 A467G probably benign Het
Mbtd1 T A 11: 93,932,212 probably null Het
Mill1 T A 7: 18,264,877 Y337* probably null Het
Mlxipl A T 5: 135,137,263 Q833L probably benign Het
Mon2 C T 10: 123,038,610 V278M probably damaging Het
Mxra8 A C 4: 155,841,733 M180L probably benign Het
Myo1c T G 11: 75,665,831 probably null Het
Myo1g T C 11: 6,510,203 T782A probably benign Het
Ncapd3 A G 9: 27,064,105 probably benign Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nedd4l T A 18: 65,195,185 probably benign Het
Nf2 T C 11: 4,791,185 K343R possibly damaging Het
Nfasc A T 1: 132,603,846 D733E possibly damaging Het
Nolc1 G A 19: 46,084,159 D699N probably damaging Het
Nrbp2 C T 15: 76,088,976 A45T probably benign Het
Obscn A G 11: 59,061,522 V3907A possibly damaging Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1371 T C 11: 52,213,749 Q80R possibly damaging Het
Olfr145 A T 9: 37,898,055 Y217F probably damaging Het
Pank2 C T 2: 131,282,606 T290I probably damaging Het
Pbx4 T C 8: 69,864,879 V171A probably benign Het
Pcgf1 G T 6: 83,080,574 V75F probably damaging Het
Pik3ca T C 3: 32,461,511 S778P probably damaging Het
Pld6 T C 11: 59,785,221 I141M probably damaging Het
Polq T A 16: 37,094,502 V2508E probably damaging Het
Prkca C G 11: 108,014,376 D179H possibly damaging Het
Pspn T C 17: 56,999,720 S70G probably damaging Het
Ptchd4 C T 17: 42,503,746 T846I probably benign Het
Reg3g A C 6: 78,467,844 Y50* probably null Het
Rev3l C T 10: 39,828,143 H2062Y probably benign Het
Rsph4a C T 10: 33,912,991 Q611* probably null Het
Scgb1b20 G A 7: 33,373,314 probably null Het
Sfxn5 T C 6: 85,269,973 probably benign Het
Sh3tc1 T A 5: 35,700,307 Q1179L possibly damaging Het
Skint11 A G 4: 114,194,565 I37V probably benign Het
Slc35f5 T C 1: 125,576,169 probably benign Het
Slc8a2 A C 7: 16,157,339 D768A probably damaging Het
Slco6b1 A G 1: 96,997,184 noncoding transcript Het
Smurf2 T A 11: 106,836,105 T453S probably benign Het
Spag16 A G 1: 70,493,768 probably benign Het
Spindoc G A 19: 7,374,144 T205I probably benign Het
Stab1 T C 14: 31,148,945 I1316V probably benign Het
Stox2 T C 8: 47,193,865 R187G probably damaging Het
Tcea2 A C 2: 181,684,481 T93P probably benign Het
Tenm4 T C 7: 96,895,623 M2311T probably benign Het
Tmem63a A G 1: 180,960,461 Q260R probably benign Het
Tnpo2 A T 8: 85,053,529 H698L probably benign Het
Trim33 A G 3: 103,310,384 D215G probably damaging Het
Ttc3 T A 16: 94,426,212 I727N probably damaging Het
Ttn T A 2: 76,943,325 K2271N probably damaging Het
Ubr2 T A 17: 46,986,779 K223* probably null Het
Ubr4 A G 4: 139,416,875 M1410V possibly damaging Het
Ugt2b35 T C 5: 87,003,412 probably benign Het
Ulk4 T A 9: 121,152,325 H880L probably benign Het
Unc80 G A 1: 66,622,474 C1686Y possibly damaging Het
Upf2 T A 2: 5,957,667 L60Q unknown Het
Usf2 A T 7: 30,954,736 probably benign Het
Usp21 T A 1: 171,283,012 probably benign Het
Usp21 T A 1: 171,283,014 probably benign Het
Vmn2r118 T A 17: 55,610,970 K181* probably null Het
Vmn2r124 T A 17: 18,073,729 S693T possibly damaging Het
Vmn2r76 C A 7: 86,228,779 G470V probably benign Het
Vps13c A C 9: 67,930,735 I1856L probably benign Het
Vps50 C T 6: 3,520,210 L119F probably damaging Het
Wdfy3 T A 5: 101,890,789 S2012C probably damaging Het
Zfp142 A G 1: 74,571,555 V924A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp235 T C 7: 24,142,219 S688P probably damaging Het
Zfp39 C T 11: 58,889,987 V650I probably benign Het
Zfp82 A T 7: 30,056,840 N272K probably damaging Het
Zfyve21 A C 12: 111,823,264 D54A possibly damaging Het
Zfyve26 C T 12: 79,244,484 D2116N probably damaging Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77847938 missense probably damaging 1.00
IGL00753:Myo18a APN 11 77825151 missense probably damaging 1.00
IGL01137:Myo18a APN 11 77827829 missense probably damaging 1.00
IGL01536:Myo18a APN 11 77820851 missense probably damaging 1.00
IGL01642:Myo18a APN 11 77864732 missense probably benign 0.07
IGL01728:Myo18a APN 11 77777856 missense probably damaging 0.99
IGL01780:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02286:Myo18a APN 11 77777985 nonsense probably null
IGL02350:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02357:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02420:Myo18a APN 11 77818693 missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77778172 missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77857852 splice site probably benign
IGL02869:Myo18a APN 11 77864786 missense probably damaging 1.00
IGL02869:Myo18a APN 11 77829873 splice site probably benign
IGL02962:Myo18a APN 11 77778235 missense probably damaging 1.00
IGL02963:Myo18a APN 11 77842018 splice site probably benign
IGL03410:Myo18a APN 11 77848004 missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77818770 missense probably benign 0.00
R0022:Myo18a UTSW 11 77843233 critical splice donor site probably null
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0098:Myo18a UTSW 11 77845765 missense probably damaging 1.00
R0322:Myo18a UTSW 11 77829800 missense probably damaging 1.00
R0373:Myo18a UTSW 11 77821042 missense probably benign 0.01
R0379:Myo18a UTSW 11 77850806 missense possibly damaging 0.84
R0688:Myo18a UTSW 11 77824140 missense probably damaging 1.00
R0734:Myo18a UTSW 11 77847404 missense probably damaging 1.00
R0790:Myo18a UTSW 11 77840709 missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77818901 splice site probably null
R1103:Myo18a UTSW 11 77823330 missense probably damaging 1.00
R1183:Myo18a UTSW 11 77857745 missense probably damaging 1.00
R1216:Myo18a UTSW 11 77818647 missense probably benign 0.35
R1331:Myo18a UTSW 11 77841579 missense probably benign 0.28
R1479:Myo18a UTSW 11 77842194 missense probably benign 0.04
R1723:Myo18a UTSW 11 77853314 missense probably damaging 0.97
R1742:Myo18a UTSW 11 77841467 missense probably damaging 0.99
R1796:Myo18a UTSW 11 77829344 missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77825097 splice site probably benign
R1827:Myo18a UTSW 11 77818771 missense probably benign 0.00
R2033:Myo18a UTSW 11 77843099 splice site probably null
R2043:Myo18a UTSW 11 77823363 missense probably damaging 0.99
R2105:Myo18a UTSW 11 77850234 missense probably benign
R2191:Myo18a UTSW 11 77818615 missense probably damaging 0.99
R2264:Myo18a UTSW 11 77819972 splice site probably benign
R2370:Myo18a UTSW 11 77777770 missense probably benign 0.03
R3015:Myo18a UTSW 11 77859020 intron probably benign
R3433:Myo18a UTSW 11 77818044 intron probably null
R3739:Myo18a UTSW 11 77845615 missense probably damaging 1.00
R3825:Myo18a UTSW 11 77777466 missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77812013 missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77829708 missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77857787 missense probably damaging 1.00
R4620:Myo18a UTSW 11 77817947 missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77824136 missense probably damaging 1.00
R4647:Myo18a UTSW 11 77817950 missense probably damaging 1.00
R4701:Myo18a UTSW 11 77817665 missense probably damaging 1.00
R4729:Myo18a UTSW 11 77777685 unclassified probably null
R4731:Myo18a UTSW 11 77829759 missense probably benign 0.00
R4739:Myo18a UTSW 11 77823323 missense probably damaging 1.00
R4814:Myo18a UTSW 11 77859236 intron probably benign
R4889:Myo18a UTSW 11 77832412 missense probably damaging 1.00
R4988:Myo18a UTSW 11 77845521 critical splice donor site probably null
R5172:Myo18a UTSW 11 77824098 missense probably damaging 1.00
R5177:Myo18a UTSW 11 77864842 utr 3 prime probably benign
R5394:Myo18a UTSW 11 77853350 missense probably benign 0.14
R5643:Myo18a UTSW 11 77854687 missense probably benign 0.12
R5808:Myo18a UTSW 11 77829301 missense probably benign 0.34
R5871:Myo18a UTSW 11 77832480 missense probably damaging 1.00
R5936:Myo18a UTSW 11 77818213 missense probably damaging 1.00
R6017:Myo18a UTSW 11 77841523 missense probably damaging 0.96
R6053:Myo18a UTSW 11 77818176 missense probably damaging 1.00
R6271:Myo18a UTSW 11 77820809 missense probably damaging 1.00
R6486:Myo18a UTSW 11 77864822 missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77850852 missense probably damaging 0.99
R6884:Myo18a UTSW 11 77819049 missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77845515 missense probably benign 0.06
R6993:Myo18a UTSW 11 77859074 intron probably benign
R7071:Myo18a UTSW 11 77823827 missense probably damaging 1.00
R7074:Myo18a UTSW 11 77842561 missense probably benign 0.03
R7238:Myo18a UTSW 11 77842233 missense probably damaging 0.96
R7328:Myo18a UTSW 11 77807911 missense
Y5407:Myo18a UTSW 11 77777815 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATGGAGAGTGCCAACCTACACCAG -3'
(R):5'- TCATAGATCACCCTGCTGCTACCG -3'

Sequencing Primer
(F):5'- CTCTGGGAGGTAAGAGTCTCTAAC -3'
(R):5'- TGCTGCTACCGCCAGAAG -3'
Posted On2013-06-12