Incidental Mutation 'R6034:Sec16b'
ID480545
Institutional Source Beutler Lab
Gene Symbol Sec16b
Ensembl Gene ENSMUSG00000026589
Gene NameSEC16 homolog B (S. cerevisiae)
SynonymsRgpr, Lztr2, Rgpr-p117
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location157506728-157568425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157552939 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 360 (K360I)
Ref Sequence ENSEMBL: ENSMUSP00000119359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027881] [ENSMUST00000086130] [ENSMUST00000111700] [ENSMUST00000146873]
Predicted Effect probably damaging
Transcript: ENSMUST00000027881
AA Change: K549I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027881
Gene: ENSMUSG00000026589
AA Change: K549I

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086130
AA Change: K549I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083300
Gene: ENSMUSG00000026589
AA Change: K549I

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 271 370 4.8e-8 PFAM
Pfam:Sec16_C 437 677 2.2e-45 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111700
AA Change: K549I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107329
Gene: ENSMUSG00000026589
AA Change: K549I

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146873
AA Change: K360I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119359
Gene: ENSMUSG00000026589
AA Change: K360I

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
Pfam:Sec16 81 182 9.4e-20 PFAM
Pfam:Sec16_C 247 492 4.8e-39 PFAM
low complexity region 606 621 N/A INTRINSIC
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Sec16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Sec16b APN 1 157538330 missense probably damaging 1.00
IGL00645:Sec16b APN 1 157566719 missense probably damaging 1.00
IGL00763:Sec16b APN 1 157529257 missense probably benign 0.00
IGL00822:Sec16b APN 1 157564555 missense probably benign 0.05
IGL02225:Sec16b APN 1 157532044 unclassified probably benign
IGL02746:Sec16b APN 1 157546289 splice site probably benign
IGL03031:Sec16b APN 1 157560799 missense probably benign
IGL03117:Sec16b APN 1 157535400 missense probably damaging 1.00
IGL03193:Sec16b APN 1 157535393 missense probably benign 0.01
R0206:Sec16b UTSW 1 157552935 nonsense probably null
R0208:Sec16b UTSW 1 157552935 nonsense probably null
R0349:Sec16b UTSW 1 157532176 splice site probably null
R0433:Sec16b UTSW 1 157534709 nonsense probably null
R0537:Sec16b UTSW 1 157537546 missense possibly damaging 0.91
R0593:Sec16b UTSW 1 157532148 missense probably benign 0.03
R0629:Sec16b UTSW 1 157564863 unclassified probably benign
R1028:Sec16b UTSW 1 157560917 missense probably benign 0.03
R1119:Sec16b UTSW 1 157564834 missense possibly damaging 0.93
R1835:Sec16b UTSW 1 157531312 missense probably benign 0.00
R1894:Sec16b UTSW 1 157552975 missense possibly damaging 0.90
R2307:Sec16b UTSW 1 157535492 missense probably damaging 1.00
R3438:Sec16b UTSW 1 157556758 splice site probably benign
R4788:Sec16b UTSW 1 157561524 missense possibly damaging 0.77
R5109:Sec16b UTSW 1 157564791 nonsense probably null
R5235:Sec16b UTSW 1 157534764 missense probably benign 0.00
R5942:Sec16b UTSW 1 157531350 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6081:Sec16b UTSW 1 157560754 missense probably benign
R7026:Sec16b UTSW 1 157534711 missense possibly damaging 0.80
R7192:Sec16b UTSW 1 157529443 missense probably benign 0.00
R7270:Sec16b UTSW 1 157564462 missense probably damaging 1.00
R7270:Sec16b UTSW 1 157564463 missense probably damaging 1.00
R7404:Sec16b UTSW 1 157531357 missense probably damaging 1.00
R7494:Sec16b UTSW 1 157560799 missense probably benign
R7570:Sec16b UTSW 1 157531395 splice site probably null
Z1088:Sec16b UTSW 1 157558024 splice site probably null
Predicted Primers
Posted On2017-06-26