Incidental Mutation 'R6034:Lilra5'
ID480557
Institutional Source Beutler Lab
Gene Symbol Lilra5
Ensembl Gene ENSMUSG00000070873
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
SynonymsGm4878
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4237754-4243463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4242134 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 259 (L259P)
Ref Sequence ENSEMBL: ENSMUSP00000113091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117550]
Predicted Effect probably benign
Transcript: ENSMUST00000117550
AA Change: L259P

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: L259P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 4.67e-4 SMART
IG_like 129 217 5.13e0 SMART
transmembrane domain 250 267 N/A INTRINSIC
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Lilra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Lilra5 APN 7 4237969 missense probably benign
IGL02281:Lilra5 APN 7 4238783 missense probably benign 0.00
R0458:Lilra5 UTSW 7 4238219 missense probably benign 0.26
R0611:Lilra5 UTSW 7 4242233 missense probably benign
R0685:Lilra5 UTSW 7 4241957 splice site probably benign
R3195:Lilra5 UTSW 7 4238757 missense probably damaging 0.96
R4726:Lilra5 UTSW 7 4237958 missense probably benign 0.00
R4745:Lilra5 UTSW 7 4242077 missense possibly damaging 0.72
R4836:Lilra5 UTSW 7 4238714 missense possibly damaging 0.71
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6263:Lilra5 UTSW 7 4238361 missense probably damaging 1.00
R6266:Lilra5 UTSW 7 4241928 missense possibly damaging 0.84
R6285:Lilra5 UTSW 7 4242115 missense probably damaging 1.00
R6292:Lilra5 UTSW 7 4238339 missense possibly damaging 0.81
R6344:Lilra5 UTSW 7 4238786 missense probably damaging 1.00
R6861:Lilra5 UTSW 7 4241932 missense probably benign 0.14
Predicted Primers
Posted On2017-06-26