Incidental Mutation 'R6034:Phf12'
ID480568
Institutional Source Beutler Lab
Gene Symbol Phf12
Ensembl Gene ENSMUSG00000037791
Gene NamePHD finger protein 12
Synonyms2410142K10Rik, PF1
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location77982754-78030539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78018069 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 325 (N325S)
Ref Sequence ENSEMBL: ENSMUSP00000103997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049167] [ENSMUST00000108360]
Predicted Effect probably benign
Transcript: ENSMUST00000049167
AA Change: N325S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044990
Gene: ENSMUSG00000037791
AA Change: N325S

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
Pfam:PHF12_MRG_bd 202 241 1.3e-21 PFAM
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Blast:FHA 813 868 9e-34 BLAST
low complexity region 905 916 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108360
AA Change: N325S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103997
Gene: ENSMUSG00000037791
AA Change: N325S

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
PDB:2L9S|A 201 241 2e-20 PDB
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Phf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Phf12 APN 11 78015506 missense probably damaging 0.98
IGL00919:Phf12 APN 11 77983340 missense probably damaging 1.00
IGL01434:Phf12 APN 11 78023559 missense probably damaging 1.00
IGL02219:Phf12 APN 11 77984196 missense probably damaging 0.97
IGL02727:Phf12 APN 11 78023667 missense possibly damaging 0.83
IGL03064:Phf12 APN 11 77983360 missense probably damaging 1.00
IGL03117:Phf12 APN 11 78023020 unclassified probably benign
R0457:Phf12 UTSW 11 78018168 missense possibly damaging 0.94
R0477:Phf12 UTSW 11 78023070 missense possibly damaging 0.94
R0656:Phf12 UTSW 11 78029332 missense probably benign 0.44
R0905:Phf12 UTSW 11 78009404 nonsense probably null
R1719:Phf12 UTSW 11 78023601 missense probably damaging 1.00
R1742:Phf12 UTSW 11 78009486 missense probably benign 0.04
R1826:Phf12 UTSW 11 78024954 splice site probably benign
R2270:Phf12 UTSW 11 77984175 missense possibly damaging 0.82
R2875:Phf12 UTSW 11 78009747 missense probably damaging 1.00
R2885:Phf12 UTSW 11 78023769 missense possibly damaging 0.75
R5020:Phf12 UTSW 11 78023796 missense probably damaging 1.00
R5570:Phf12 UTSW 11 78018111 missense possibly damaging 0.89
R5573:Phf12 UTSW 11 78025045 missense probably damaging 1.00
R5689:Phf12 UTSW 11 78023725 missense probably damaging 1.00
R5727:Phf12 UTSW 11 78023544 missense probably damaging 1.00
R5807:Phf12 UTSW 11 78022426 missense probably benign 0.16
R5910:Phf12 UTSW 11 78027398 missense probably damaging 1.00
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6049:Phf12 UTSW 11 78028170 unclassified probably null
R6052:Phf12 UTSW 11 78018218 missense probably benign 0.31
R6056:Phf12 UTSW 11 78009515 missense probably benign 0.09
R6208:Phf12 UTSW 11 78023591 missense probably damaging 0.97
R6644:Phf12 UTSW 11 78026092 makesense probably null
R6805:Phf12 UTSW 11 78027373 missense probably damaging 1.00
R6823:Phf12 UTSW 11 78022511 nonsense probably null
R7047:Phf12 UTSW 11 78013273 missense probably damaging 0.99
R7159:Phf12 UTSW 11 78023540 missense possibly damaging 0.76
X0013:Phf12 UTSW 11 78009791 missense probably damaging 1.00
X0027:Phf12 UTSW 11 78028895 unclassified probably null
Predicted Primers
Posted On2017-06-26